ccpN [2019-09-18 11:37:49]

transcriptional repressor (CcpN family) of gluconeogenetic genes and of sr1. repression in the presence of glucose

Locus: BSU_25250

Isoelectric point: 7.22

Molecular weight: 23.72 kDa

Protein length: 212 aa

Gene length: 639 bp

Function: repressor of genes involved in gluconeogenesis (gapB, pckA) and of sr1

Product: transcriptional regulator (CcpN family)

Essential: no

Synonyms: yqzB

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Carbon core metabolism → Gluconeogenesis
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other
• Information processing → Regulation of gene expression → Regulators of core metabolism

Gene

Coordinates: 2,604,959 2,605,597

Phenotypes of a mutant

• Impaired growth on glucose due to re-routing of carbon from glycolysis to the pentose phosphate pathway PubMed

The protein

Catalyzed reaction/ biological activity

• transcription repression of the gapB, pckA, and sr1 genes in the presence of glucose PubMed

Protein family

• CcpN family

Domains

• 2 CBS domains (aa 83-139, aa 148-211) (according to UniProt)

Effectors of protein activity

• YqfL (negative effector of CcpN activity) PubMed
• ATP enhances CcpN-dependent repression, ADP counteracts the repressing activity of CcpN PubMed

Structure

• 3FV6 (the CBS domains, aa 63 ... 212)

Additional information

• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: ccpN-yqfL
  Description: PubMed

  Regulation

  • constitutive PubMed

  Additional information

  • the intracellular concentration of CcpN is about 4 myM (according to PubMed).

Biological materials

Mutant

• MGNA-C493 (yqzB::erm), available at the NBRP B. subtilis, Japan
• DB104 ccpN::cat, available in Sabine Brantl's lab
• GP1128 ccpN::cat, available in Jörg Stülke's lab
• BKE25250 (ccpN::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG
• BKK25250 (ccpN::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG

Expression vectors

• pGP2923 (N-terminal His-tag, purification from E. coli, in pWH844), available in Jörg Stülke's lab

Antibody

• available in Sabine Brantl's lab

Labs working on this gene/protein

• Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France
• Sabine Brantl, Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany homepage
• Uwe Sauer, ETH Zrich, Switzerland homepage

References

Reviews

Loading

Original Publications

Loading