SubtiBank SubtiBank
ccpN
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ccpN

transcriptional repressor (CcpN family) of gluconeogenetic genes and of [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1], repression in the presence of glucose, involved in the control of cell elongation
locus
BSU_25250
pI
7.22
mw
23.72 kDa
protein length
212 aa Sequence Blast
gene length
639 bp Sequence Blast
function
repressor of genes involved in gluconeogenesis ([gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB], [gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]) and of [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]
product
transcriptional regulator (CcpN family)
essential
no
synonyms
yqzB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    2,604,959 2,605,597

    Phenotypes of a mutant

  • Impaired growth on glucose due to re-routing of carbon from glycolysis to the pentose phosphate pathway [Pubmed|18586936]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'', ''[gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]'', and ''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]'' genes in the presence of glucose [Pubmed|2548995]
  • Protein family

  • [SW|CcpN family]
  • [SW|Domains]

  • [SW|HTH deoR-type domain] (aa 6-70) (according to UniProt)
  • 2 [SW|CBS domain]s (aa 83-139, aa 148-211) (according to UniProt)
  • Effectors of protein activity

  • [protein|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|YqfL] (negative effector of CcpN activity) [Pubmed|15720552]
  • ATP enhances CcpN-dependent repression, ADP counteracts the repressing activity of CcpN [Pubmed|18511073]
  • Structure

  • [PDB|3FV6] (the [SW|CBS domain]s, aa 63 ... 212)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000231 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]-[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]
    description
    [Pubmed|15720552]

    regulation

  • constitutive [Pubmed|15720552]
  • additional information

  • the intracellular concentration of CcpN is about 4 myM (according to [PubMed|20408793]).
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C493 (yqzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2491 NBRP B. subtilis, Japan]
  • DB104 ''ccpN''::cat, available in [SW|Sabine Brantl]'s lab
  • GP1128 ''ccpN''::cat, available in [SW|Jörg Stülke]'s lab
  • BKE25250 ([gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG
  • BKK25250 ([gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG
  • Expression vectors

  • pGP2923 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Sabine Brantl]'s lab
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • [SW|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [http://www.uni-jena.de/AG_Bakteriengenetik_(_Doz__Dr__Sabine_Brantl_).html homepage]
  • [SW|Uwe Sauer], ETH Zrich, Switzerland [http://www.imsb.ethz.ch/researchgroup/sauer homepage]
  • References

    Reviews

  • 20408793
  • Original Publications

  • 15720552,16164558,17011578,18511073,18586936,19726675,19732150,22190493,23280112,32762636