SubtiBank SubtiBank
ccpN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ccpN

transcriptional repressor (CcpN family) of gluconeogenetic genes and of sr1. repression in the presence of glucose
locus
BSU_25250
pI
7.22
mw
23.72 kDa
protein length
212 aa Sequence Blast
gene length
639 bp Sequence Blast
function
repressor of genes involved in gluconeogenesis ([gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB], [gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]) and of [gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]
product
transcriptional regulator (CcpN family)
essential
no
synonyms
yqzB

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW 2.2.1.2|Gluconeogenesis]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.5|Transcription factors/ other]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.5|Regulators of core metabolism]
  • Gene

    Coordinates
    2,604,959 2,605,597

    Phenotypes of a mutant

  • Impaired growth on glucose due to re-routing of carbon from glycolysis to the pentose phosphate pathway [Pubmed|18586936]
  • The protein

    Catalyzed reaction/ biological activity

  • transcription repression of the ''[gene|C1B89BD3DD27CD566018558D3A7845FB451056F0|gapB]'', ''[gene|74D4616D1A550D87182FAAC2A4AF6E04F81E1572|pckA]'', and ''[gene|FC93BA60BD185DE5EF31D5605F0B8294EC2E8E5A|sr1]'' genes in the presence of glucose [Pubmed|2548995]
  • Protein family

  • [SW|CcpN family]
  • [SW|Domains]

  • 2 [SW|CBS domain]s (aa 83-139, aa 148-211) (according to UniProt)
  • Effectors of protein activity

  • [protein|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|YqfL] (negative effector of CcpN activity) [Pubmed|15720552]
  • ATP enhances CcpN-dependent repression, ADP counteracts the repressing activity of CcpN [Pubmed|18511073]
  • Structure

  • [PDB|3FV6] (the [SW|CBS domain]s, aa 63 ... 212)
  • additional information

  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000231 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]-[gene|B3C0FE9DD3CB4AF34DD57CF4D03ABE8AFF1346C7|yqfL]
    description
    [Pubmed|15720552]

    regulation

  • constitutive [Pubmed|15720552]
  • additional information

  • the intracellular concentration of CcpN is about 4 myM (according to [PubMed|20408793]).
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C493 (yqzB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2491 NBRP B. subtilis, Japan]
  • DB104 ''ccpN''::cat, available in [SW|Sabine Brantl]'s lab
  • GP1128 ''ccpN''::cat, available in [SW|Jörg Stülke]'s lab
  • BKE25250 ([gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG
  • BKK25250 ([gene|2234D81F8F9B92EAF1CF6F73BEC92D4DE54E2636|ccpN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25250 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACCACCTTTTCACTTCATA, downstream forward: _UP4_TAAGATTGCAAACTAACGGG
  • Expression vectors

  • pGP2923 (N-terminal His-tag, purification from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • Antibody

  • available in [SW|Sabine Brantl]'s lab
  • labs

  • [SW|Stephane Aymerich], Microbiology and Molecular Genetics, INRA Paris-Grignon, France
  • [SW|Sabine Brantl], Bacterial Genetics, Friedrich-Schiller-University of Jena, Germany [http://www.uni-jena.de/AG_Bakteriengenetik_(_Doz__Dr__Sabine_Brantl_).html homepage]
  • [SW|Uwe Sauer], ETH Zrich, Switzerland [http://www.imsb.ethz.ch/researchgroup/sauer homepage]
  • References

    Reviews

  • 20408793
  • Original Publications

  • 15720552,16164558,17011578,18511073,18586936,19726675,19732150,22190493,23280112