SubtiBank SubtiBank
yhfU
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhfU

S protein of biotin [SW|ECF transporter]
locus
BSU_10370
pI
10.68
mw
19.87 kDa
protein length
186 aa Sequence Blast
gene length
561 bp Sequence Blast
function
uptake of biotin
product
S protein of biotin [SW|ECF transporter]
essential
no
synonyms
bioY

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter]
  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.3|ECF transporter] → [category|SW 1.2.3.2|The substrate-specific S components of the ECF transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW 2.6.2.1|Biosynthesis/ acquisition of biotin]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,111,925 1,112,485

    The protein

    Catalyzed reaction/ biological activity

  • uptake of biotin [Pubmed|17301237]
  • Protein family

  • bioY family (with [protein|E98078C3CB9F19949009A8E50340E4C9E67663E6|YuiG], according to UniProt)
  • Structure

  • [PDB|4DVE] (BioY from ''Lactococcus lactis'', 35% identity, 71% similarity) [Pubmed|22891302]
  • [SW|Localization]

  • membrane associated [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|yhfU]-[gene|5050649605DD782AF10FC0AEEA5F14036EC0197D|yhfT]-[gene|CF6B79564DBED3C6CAF64D01BD01D2A03675F16F|yhfS]-[gene|73CB11C654E7A92D6F59B00E0710D3AA1FD2F099|yhfR]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA]: repression, [Pubmed|11717296], in [regulon|F761DBCE3429C99159F8F7CD8596FD9CF2D0589D|BirA regulon]
  • regulation

  • repressed in the presence of biotin ([protein|search|BirA]) [Pubmed|11717296]
  • additional information

  • weakly expressed [http://www.ncbi.nlm.nih.gov/sites/entrez/10869096 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B281 (yhfU::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1280 NBRP B. subtilis, Japan]
  • BKE10370 ([gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|yhfU]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE10370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAATCCTCCAAAAA, downstream forward: _UP4_TTTACAAAAGGAGGATGACA
  • BKK10370 ([gene|22215066A7BEA4E53189DE6639C19D1AD86DA7F4|yhfU]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK10370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTGAAATCCTCCAAAAA, downstream forward: _UP4_TTTACAAAAGGAGGATGACA
  • References

  • 21437340,20497229,22574898,24362466,17301237,22891302,18763711,22383849,11717296,12368242