SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


Pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE] protease
34.70 kDa
protein length
309 aa Sequence Blast
gene length
930 bp Sequence Blast
maturation of [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]
Pro-[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE] protease

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.7|Proteolysis] → [category|SW|Proteolysis during sporulation/ germination]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.3|Sporulation/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,603,779 1,604,708

    The protein

    Protein family

  • peptidase U4 family (according to Swiss-Prot)
  • Effectors of protein activity

  • [protein|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|SpoIIGA] protease activity is stimulated by the interaction with [protein|9F338225E1286D530EAAAB504DEC8D5AFA06AC8D|SpoIIR] in the intermembrane space between the forespore and the mother cell [Pubmed|22111992]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|2512576], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|1902213], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulatory mechanism

  • [protein|5A6FBAE6553343092862CB79E150F934978C32A9|SinR]: repression, in [regulon|5A6FBAE6553343092862CB79E150F934978C32A9|SinR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [PubMed|8288522,15687200], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • ''[SW|spoIIGA]'': expressed under conditions that trigger sporulation ([SW|Spo0A]) [,15687200 PubMed]
  • additional information

  • the mRNA half-life is about 2.6 min [PubMed|24163345]
  • view in new tab

    Biological materials


  • BKE15310 ([gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCTGACTCCTTTCTTT, downstream forward: _UP4_TAATGTTCGCAAATGTCCGT
  • BKK15310 ([gene|221829E084DA78ACE1C2DFCEB6E59EDA534FF55D|spoIIGA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACATCTGACTCCTTTCTTT, downstream forward: _UP4_TAATGTTCGCAAATGTCCGT
  • References

  • 19581368,1537790,2448286,8288522,8231806,8002606,8730857,1744037,9287022,7585939,18296515,8288522,15687200