SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


41.15 kDa
protein length
368 aa Sequence Blast
gene length
1107 bp Sequence Blast
control of SigX activity

Genomic Context



  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.1|Sigma factors and their control] → [category|SW|Control of sigma factors]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    2,413,585 2,414,691

    Phenotypes of a mutant

  • inactivation of ''[gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • The protein


  • cell membrane (according to UniProt)
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9636707], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|9636707], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • regulatory mechanism

  • [protein|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb]: activation, [Pubmed|16306698], in [regulon|7098319D8E88FDC2A629A3F4A21507FD7A649385|YvrHb regulon]
  • regulation

  • induced by glucose [Pubmed|27965645], this depends on [protein|F4097349A563503468A2A14F062AEAC532C7917A|YlxR] [pubmed|30355672]
  • view in new tab

    Biological materials


  • MGNA-A180 (ypuN::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE23090 ([gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATCCTGAGGCGAACGAT, downstream forward: _UP4_TAAAAAGAGCCCTTTAAGGC
  • BKK23090 ([gene|21D260E900776EAAF4B6000A3365DCA9241EACA6|rsiX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_AATATCCTGAGGCGAACGAT, downstream forward: _UP4_TAAAAAGAGCCCTTTAAGGC
  • References

  • 14993308,7934830,16306698,9636707,9393439,22211522