SubtiBank SubtiBank
spsA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

spsA

nucleotide-sugar-dependent glycosyltransferase, spore coat polysaccharide synthesis
locus
BSU_37910
pI
5.36
mw
30.03 kDa
protein length
256 aa Sequence Blast
gene length
771 bp Sequence Blast
function
spore coat polysaccharide synthesis
product
nucleotide-sugar-dependent glycosyltransferase
essential
no
synonyms
ipa-63d

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    3,892,351 3,893,121

    Phenotypes of a mutant

  • reduced [SW|germination] efficiency [Pubmed|25239894]
  • The protein

    Protein family

  • [SW|glycosyltransferase 2 family] [Pubmed|10350455]
  • Paralogous protein(s)

  • [protein|9EDE093896E8535962903D7A202D69C1BC402C09|CgeD]: the N-terminal 220 aa of [protein|9EDE093896E8535962903D7A202D69C1BC402C09|CgeD] and [protein|219B0AAFB4ABB7E97A906553B73423F712505E27|SpsA]: 45.5% identity
  • Structure

  • [PDB|1QGS] (complex with UDP) [Pubmed|10350455]
  • [PDB|1H7Q] [Pubmed|11733986]
  • Expression and Regulation

    Operons

    genes
    [gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]-[gene|9E577B935FAB9605DAF83353E907A6561F11CAC1|spsB]-[gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]-[gene|2648D9E356683F5E9C00C40F0A6BBD1933322B09|spsD]-[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]-[gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]-[gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]-[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]-[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]-[gene|4A4C5E6C1DFD46BC3CF9AEBA3FC1577767FF8465|spsK]-[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]
    description
    [Pubmed|9353933]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|26577401], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • [protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK]: sigma factor, [Pubmed|15383836], in [regulon|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|SigK regulon]
  • regulatory mechanism

  • [protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE]: activation, [Pubmed|25239894,15383836], in [regulon|19228BAD44E6DA3DE908DC390FDF628C18D94E65|GerE regulon]
  • regulation

  • expressed during [SW|sporulation] in the mother cell ([SW|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
  • additional information

  • the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE37910 ([gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTACACCTCCTTCT, downstream forward: _UP4_AAAAAGCTTGGAATGGGGTG
  • BKK37910 ([gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37910 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATCCTACACCTCCTTCT, downstream forward: _UP4_AAAAAGCTTGGAATGGGGTG
  • References

  • 9353933,15383836,11733986,10350455,25239894,26577401