SubtiBank SubtiBank
ytnA [2018-02-10T06:41:21.000Z]
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytnA [2018-02-10T06:41:21.000Z]

similar to proline permease
locus
BSU30530
pI
9.91
mw
50.16 kDa
protein length
463 aa Sequence Blast
gene length
1389 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.3|Biosynthesis/ acquisition of proline/ based on similarity]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.3|Utilization of proline/ based on similarity]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,124,250 → 3,125,641

    The protein

    Paralogous protein(s)

  • [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP], [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW]
  • Expression and Regulation

    Operons

    genes
    [gene|6F5BBCBA02EA1C016AA37EB63D252A4C07CE6617|asnB]-[gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]
    description
    [Pubmed|10498721]

    regulation

  • constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A126 (ytnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/126 NBRP B. subtilis, Japan]
  • GP1885 (spec) available in [SW|Jörg Stülke]'s lab
  • BKE30530 (Δ[gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA, downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
  • BKK30530 (Δ[gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA, downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
  • References

  • 10498721