SubtiBank SubtiBank
ytnA
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ytnA

alanine permease
locus
BSU_30530
pI
9.91
mw
50.16 kDa
protein length
463 aa Sequence Blast
gene length
1392 bp Sequence Blast
function
uptake of D- and L-alanine
product
alanine permease
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.15|Biosynthesis/acquisition of L- and D-alanine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,124,250 3,125,641

    Phenotypes of a mutant

  • a [gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA] [gene|CB0B6C69CB5CFF6FE30C3F95991F309C8DE1E344|alr] double mutant is not viable due to the inability to acquire D-alanine [https://www.biorxiv.org/content/10.1101/562850v2 reference]
  • The protein

    Catalyzed reaction/ biological activity

  • uptake of D- and L-alanine [https://www.biorxiv.org/content/10.1101/562850v2 reference]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|423AEC9D260BE53AD22851D999244B89BEB3E84D|HutM], [protein|8C4A8961B2514A8AD531AFB104B10C0797D02AC2|YvbW], [protein|9AD0E43119BDC65D5F67CE55CD9417E1E6BAE058|YbxG], [protein|9BFB16C12B31ABD70BBB921BCB9E4201E3BDC92D|RocC], [protein|B46A8BCEC56E6252712E30F8BF8DA6B836FDE2F6|RocE], [protein|B6A920650919D5BBBD75CCA58C30A0D8ECE64DA3|YbgF], [protein|C7FEA1D9C7C96C39CEE83CE3F13D412DE6AFE10E|YdgF], [protein|CE4A49F5CCC2D36C5CE5AD7AE7F0A70F2D4F425C|AapA], [protein|1594BA83CED2DA9F86C1CE2A0DC6E1C9B665EACB|GabP]
  • Structure

  • [PDB|6F34] (from Geobacillus kaustophilus, 21% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|6F5BBCBA02EA1C016AA37EB63D252A4C07CE6617|asnB]-[gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]
    description
    [Pubmed|10498721]

    regulation

  • constitutive
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A126 (ytnA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/126 NBRP B. subtilis, Japan]
  • GP1885 (Δ[gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::''spc'') available in [SW|Jörg Stülke]'s lab [pubmed|32743959]
  • BKE30530 ([gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE30530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA, downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
  • BKK30530 ([gene|219586A3F378DC38EA076FD39B99D41136BDE722|ytnA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK30530 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTTCTTCTCCCCTAGA, downstream forward: _UP4_TGACAAAAAGAGCTCCCAGT
  • Expression vector

  • pGP2280: expression of ''ytnA'' by [SW|pBQ200] in ''B. subtilis'', available in [SW|Jörg Stülke]'s lab
  • lacZ fusion

  • pGP2276 (in [SW|pAC5]) (GP2963), available in [SW|Jörg Stülke]'s lab
  • References

  • 10498721,29416041