SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


methylcrotonoyl-CoA carboxylase, subunit
66.13 kDa
protein length
511 aa Sequence Blast
gene length
1536 bp Sequence Blast
mother cell metabolism, leucine utilization
methylcrotonoyl-CoA carboxylase, subunit

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of branched-chain amino acids]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    1,949,682 1,951,217

    The protein

    Catalyzed reaction/ biological activity

  • 3-methylbut-2-enoyl-CoA + Biotin-CO2 -- 3-methyl-glutaconyl-CoA + biotin [Pubmed|19935659]
  • Protein family

  • AccD/PCCB family (with [protein|E4997526CC534E38413030E90F7A135ECF65DF40|AccD] and [protein|B6A05AD90A4AA553A8CCD8FFF504F5AD204ABAFB|YqjD], according to UniProt)
  • Paralogous protein(s)

  • [protein|B6A05AD90A4AA553A8CCD8FFF504F5AD204ABAFB|YqjD]
  • [SW|Domains]

  • CoA carboxyltransferase N-terminal domain (aa 2-254) (according to UniProt)
  • CoA carboxyltransferase C-terminal domain (aa 260-506) (according to UniProt)
  • Structure

  • [PDB|1VRG] (from Thermotoga maritima, 40% identity)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials


  • MGNA-B081 (yngE::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18210 ([gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAATCCATCAGCATTGCCT, downstream forward: _UP4_TAAAAGCAAGAACTTAGGAG
  • BKK18210 ([gene|2192474E13EAF6D2CF97CB957864FC89ED0118E0|yngE]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATAATCCATCAGCATTGCCT, downstream forward: _UP4_TAAAAGCAAGAACTTAGGAG
  • References

  • 15699190,12662922,19935659