SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


rhamnogalacturonanlyase, degrades oligo- to disaccharides
67.51 kDa
protein length
612 aa Sequence Blast
gene length
1839 bp Sequence Blast
utilization of rhamnogalacturonan
rhamnogalacturonan lyase, degrades oligo- to disaccharides

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of pectin]
  • Gene

    772,142 773,980

    The protein

    Catalyzed reaction/ biological activity

  • Exotype eliminative cleavage of alpha-L-rhamnopyranosyl-(1->4)-alpha-D-galactopyranosyluronic acid bonds of rhamnogalacturonan I oligosaccharides containing alpha-L-rhamnopyranose at the reducing end and 4-deoxy-4,5-unsaturated D-galactopyranosyluronic acid at the non-reducing end. The products are the disaccharide 2-O-(4-deoxy-beta-L-threo-hex-4-enopyranuronosyl)-alpha-L-rhamnopyranose and the shortened rhamnogalacturonan oligosaccharide containing one 4-deoxy-4,5-unsaturated D-galactopyranosyluronic acid at the non-reducing end (according to UniProt)
  • Protein family

  • polysaccharide lyase 11 family (with [protein|65704140C3B95619D6C0962CB40452D373E2740F|YesW], according to UniProt)
  • Paralogous protein(s)

  • [protein|65704140C3B95619D6C0962CB40452D373E2740F|YesW]
  • Structure

  • [PDB|2ZUY]
  • [SW|Localization]

  • secreted (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR]: activation, [Pubmed|19651770], in [regulon|BF0E202739BFD461E418655ECD9C3425AC556FA3|RhgR regulon]
  • regulation

  • induced by pectin ([protein|search|RhgR]) [Pubmed|19651770]
  • view in new tab

    Biological materials


  • MGNA-B261 (yesX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE07060 ([gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATGGGAACGGGCTG, downstream forward: _UP4_TAGGAGGACTAAGGGATAAG
  • BKK07060 ([gene|217BAA94FB926CDA7CA8800BC6B08371792CEE31|yesX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGATGGGAACGGGCTG, downstream forward: _UP4_TAGGAGGACTAAGGGATAAG
  • References

  • 19651770,17449691,19193638