SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


lysine 2,3-aminomutase
53.91 kDa
protein length
471 aa Sequence Blast
gene length
1413 bp Sequence Blast
lysine 2,3-aminomutase

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    2,139,454 → 2,140,869

    The protein

    Catalyzed reaction/ biological activity

  • L-lysine --> (3S)-3,6-diaminohexanoate (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • PLP (according to UniProt)
  • Structure

  • [PDB|2A5H] (from ''clostridium subterminale Sb4'' , 60% identity)
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|14523133]
  • view in new tab

    Biological materials


  • MGNA-B443 (yodO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19690 (Δ[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGAACTCCTCCTCGCG, downstream forward: _UP4_ACTGAATGCGGAGGGGATTC
  • BKK19690 (Δ[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGAACTCCTCCTCGCG, downstream forward: _UP4_ACTGAATGCGGAGGGGATTC
  • References

  • 10839984,14523133