SubtiBank SubtiBank
kamA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

kamA

lysine 2,3-aminomutase
locus
BSU_19690
pI
6.04
mw
53.91 kDa
protein length
471 aa Sequence Blast
gene length
1413 bp Sequence Blast
function
unknown
product
lysine 2,3-aminomutase
essential
no
ec
5.4.3.2
synonyms
yodO

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    2,139,454 → 2,140,869

    The protein

    Catalyzed reaction/ biological activity

  • L-lysine --> (3S)-3,6-diaminohexanoate (according to UniProt)
  • Protein family

  • [SW|Radical SAM superfamily] (according to UniProt)
  • [SW|Cofactors]

  • Fe-S cluster [pubmed|29292548]
  • PLP (according to UniProt)
  • Structure

  • [PDB|2A5H] (from ''clostridium subterminale Sb4'' , 60% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|13DC4296015A28975BC7697F134FB6ECD6B11489|yodT]-[gene|D8A050BF150C6E5B910C24C0E023F0829EC95BAD|yodS]-[gene|138832210AC94B17E081F3D0AF9BCFE3BE63E601|yodR]-[gene|161ADC907D4902001C8751F51CFA762828C26110|yodQ]-[gene|39749B5EADC3C056BAF232E0B586C65B989F7F77|yodP]-[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]-[gene|A4A099EE3368891C2AD6C2D1DCBE7B238227417F|yokU]-[gene|0A33869E05CC9B49699555EA19D0905A55CA35B9|yozE]
    description
    [Pubmed|22383849,14523133]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|14523133], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporuation in the mother cell ([protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]) [Pubmed|14523133]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B443 (yodO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1442 NBRP B. subtilis, Japan]
  • BKE19690 (Δ[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGAACTCCTCCTCGCG, downstream forward: _UP4_ACTGAATGCGGAGGGGATTC
  • BKK19690 (Δ[gene|21589FEBDE54C66DE2A3DCFC2D7BF3AEEC84B44C|kamA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19690 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAACGAACTCCTCCTCGCG, downstream forward: _UP4_ACTGAATGCGGAGGGGATTC
  • References

  • 10839984,14523133