SubtiBank SubtiBank
yjfB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yjfB

unknown
locus
BSU_12120
pI
8.95
mw
5.85 kDa
protein length
gene length
168 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    1,283,169 1,283,336

    Expression and Regulation

    Operons

    genes
    [gene|214191B235BB8EBC442399C80C52E8831193FCA7|yjfB]
    description
    [Pubmed|15033535]

    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A386 (yjfB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/386 NBRP B. subtilis, Japan]
  • BKE12120 ([gene|214191B235BB8EBC442399C80C52E8831193FCA7|yjfB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE12120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCCACCTCCTATGC, downstream forward: _UP4_TAACCTCATACCAGAGGCGG
  • BKK12120 ([gene|214191B235BB8EBC442399C80C52E8831193FCA7|yjfB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK12120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCCACCTCCTATGC, downstream forward: _UP4_TAACCTCATACCAGAGGCGG
  • References

  • 15033535