SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


5.85 kDa
protein length
gene length
168 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    1,283,169 1,283,336

    Expression and Regulation



    sigma factors

  • [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD]: sigma factor, [Pubmed|15033535], in [regulon|7024E4162A6D827069F882FDEACA696EBC05DD40|SigD regulon]
  • view in new tab

    Biological materials


  • MGNA-A386 (yjfB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE12120 ([gene|214191B235BB8EBC442399C80C52E8831193FCA7|yjfB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCCACCTCCTATGC, downstream forward: _UP4_TAACCTCATACCAGAGGCGG
  • BKK12120 ([gene|214191B235BB8EBC442399C80C52E8831193FCA7|yjfB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGGTTCCACCTCCTATGC, downstream forward: _UP4_TAACCTCATACCAGAGGCGG
  • References

  • 15033535