SubtiBank SubtiBank
yhbJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yhbJ

putative efflux system component
locus
BSU_09000
pI
4.37
mw
23.47 kDa
protein length
221 aa Sequence Blast
gene length
666 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    977,069 977,734

    The protein

    Protein family

  • [SW|Membrane fusion protein (MFP) (TC 8.A.1) family] (according to UniProt)
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|EDDD61CF725449E57C72F63D378F6CD1FAC49ADA|yhbI]-[gene|211C58A92BA2A06A34B1F73BDB68A0F581B942C2|yhbJ]-[gene|93159DC7D5C42CFA54F66F232D73F38957243AB7|yhcA]-[gene|7797B0B66922D51B9D142DD2E5857836E47F015B|yhcB]-[gene|95EED3A91483502CA78067421F678B1EDB965B18|yhcC]
    description
    [Pubmed|22383849]

    additional information

  • the mRNA is substantially stabilized upon depletion of [protein|872CCB5A49C9000BD95E4B0472556D5F60F7D7A4|RNase Y] (the half-life of the mRNA increases from 4 to 41 min) [PubMed|21815947]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B470 (yhbJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1469 NBRP B. subtilis, Japan]
  • BKE09000 ([gene|211C58A92BA2A06A34B1F73BDB68A0F581B942C2|yhbJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGCGGAAAGCTGGTG, downstream forward: _UP4_TAAAACAGATCAGTCATCAA
  • BKK09000 ([gene|211C58A92BA2A06A34B1F73BDB68A0F581B942C2|yhbJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09000 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTGCGGAAAGCTGGTG, downstream forward: _UP4_TAAAACAGATCAGTCATCAA
  • References

  • 21815947