SubtiBank SubtiBank
bcaP
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

bcaP

amino acid transporter, major transporter for isoleucine, valine and threonine, minor serine transporter
locus
BSU_09460
pI
9.73
mw
49.55 kDa
protein length
465 aa Sequence Blast
gene length
1398 bp Sequence Blast
function
uptake of branched-chain amino acids, threonine, and serine
product
amino acid transporter
essential
no
synonyms
yhdG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.4|APC superfamily]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.6|Biosynthesis/ acquisition of lysine/ threonine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.8|Biosynthesis/ acquisition of serine/ glycine/ alanine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.8|Utilization of threonine/ glycine]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,023,350 1,024,747

    Phenotypes of a mutant

  • no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
  • resistant to growth inhibition by high concentrations of threonine [Pubmed|32743959,25645558]
  • resistant to 4-hydroxythreonine [pubmed|25777134]
  • The protein

    Catalyzed reaction/ biological activity

  • high affinity uptake of isoleucine and valine [Pubmed|25645558]
  • uptake of threonine [pubmed|32743959]
  • uptake of serine [pubmed|32743959]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7E180420EB053D9EF7993EF600A169C446F905F9|MtrA]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation:

  • repressed at high concentrations of branched-chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B479 (yhdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1478 NBRP B. subtilis, Japan]
  • BKE09460 (''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]''::''erm'', available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
  • BKK09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
  • Expression vector

  • pGP2298 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18083814,12618455,20935095,18763711,21097623,21699902,25645558,25777134,29416041,32743959