SubtiBank SubtiBank
bcaP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bcaP

branched-chain amino acid transporter, major transporter for isoleucine and valine, may also be involved in threonine transport
locus
BSU_09460
pI
9.73
mw
49.55 kDa
protein length
465 aa Sequence Blast
gene length
1398 bp Sequence Blast
function
biosynthesis/acquisition of branched-chain amino acids
product
branched-chain amino acid transporter
essential
no
synonyms
yhdG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,023,350 1,024,747

    Phenotypes of a mutant

  • no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
  • resistant to growth inhibition by high concentrations of threonine [Pubmed|25645558]
  • resistant to 4-hydroxythreonine [pubmed|25777134]
  • The protein

    Catalyzed reaction/ biological activity

  • high affinity uptake of isoleucine and valine [Pubmed|25645558]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7E180420EB053D9EF7993EF600A169C446F905F9|MtrA]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation:

  • repressed at high concentrations of branched-chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B479 (yhdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1478 NBRP B. subtilis, Japan]
  • BKE09460 (''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]''::''erm'', available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
  • BKK09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
  • Expression vector

  • pGP2298 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18083814,12618455,20935095,18763711,21097623,21699902,25645558,25777134,29416041