SubtiBank SubtiBank
bcaP
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bcaP

branched-chain amino acid transporter, major transporter for isoleucine and valine, may also be involved in threonine transport
locus
BSU09460
pI
9.73
mw
49.55 kDa
protein length
465 aa Sequence Blast
gene length
1398 bp Sequence Blast
function
biosynthesis/acquisition of branched-chain amino acids
product
branched-chain amino acid transporter
essential
no
synonyms
yhdG

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    1,023,350 1,024,747

    Phenotypes of a mutant

  • no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
  • resistant to growth inhibition by high concentrations of threonine [Pubmed|25645558]
  • resistant to 4-hydroxythreonine [pubmed|25777134]
  • The protein

    Catalyzed reaction/ biological activity

  • high affinity uptake of isoleucine and valine [Pubmed|25645558]
  • Protein family

  • [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7E180420EB053D9EF7993EF600A169C446F905F9|MtrA]
  • Structure

  • [PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]
  • [SW|Localization]

  • cell membrane [Pubmed|18763711]
  • Expression and Regulation

    Operons

    genes
    [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation:

  • repressed at high concentrations of branched-chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [pubmed|12618455]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B479 (yhdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1478 NBRP B. subtilis, Japan]
  • BKE09460 (''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]''::''erm'', available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs) [pubmed|28189581]
  • BKE09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
  • BKK09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
  • Expression vector

  • pGP2298 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab
  • References

  • 18083814,12618455,20935095,18763711,21097623,21699902,25645558,25777134,29416041