Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

bcaP

branched-chain amino acid transporter, major transporter for isoleucine and valine, may also be involved in threonine transport

locus: BSU09460

pI: 9.73

mw: 49.55 kDa

protein length: 465 aa

gene length: 1398 bp

function: biosynthesis/acquisition of branched-chain amino acids

product: branched-chain amino acid transporter

essential: no

synonyms: yhdG

Genomic Context

categories

• [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.4|Transporters/ other] → [category|SW 1.2.4.1|Amino acid transporters] → [category|SW 1.2.4.1.2|Other amino acid transporters]
• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.12|Biosynthesis/ acquisition of branched-chain amino acids]
• [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW 2.3.2.9|Utilization of branched-chain amino acids]
• [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]

Gene

Coordinates: 1,023,350 1,024,747

Phenotypes of a mutant

• no phenotype for the single mutant, the triple ''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP] [gene|8BB8BDA602CC26B0A9E8C22666F0EC539306CF39|brnQ] [gene|75A874F0C344E8404BE39C32EFF59CE562193640|braB]'' mutant is strongly impaired in the transport of isoleucine and valine at low concentrations [Pubmed|25645558]
• resistant to growth inhibition by high concentrations of threonine [Pubmed|25645558]
• resistant to 4-hydroxythreonine [pubmed|25777134]

The protein

Catalyzed reaction/ biological activity

• high affinity uptake of isoleucine and valine [Pubmed|25645558]

Protein family

• [SW|amino acid-polyamine-organocation (APC) superfamily] (according to UniProt)

Paralogous protein(s)

• [protein|7E180420EB053D9EF7993EF600A169C446F905F9|MtrA]

Structure

• [PDB|5OQT] (from Geobacillus kaustophilus, 60% identity) [pubmed|29416041]

[SW|Localization]

• cell membrane [Pubmed|18763711]

Expression and Regulation

Operons

• genes: [gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]
  description: [pubmed|22383849]

  regulatory mechanism

  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, [pubmed|12618455], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]

  regulation:

  • repressed at high concentrations of branched-chain amino acids ([protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]) [pubmed|12618455]

Biological materials

Mutant

• MGNA-B479 (yhdG::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1478 NBRP B. subtilis, Japan]
• BKE09460 (''[gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]''::''erm'', available in the BGSC and in [SW|Fabian Commichau]'s and [SW|Jörg Stülke]'s labs) [pubmed|28189581]
• BKE09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG
• BKK09460 ([gene|210C83EBEBD3DE4946BC511E0249D0032A7CE3D0|bcaP]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK09460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCCCTTCAACTCCCGA, downstream forward: _UP4_TAACCTTTTGATAAAGAGAG

Expression vector

• pGP2298 (expression with N-terminal His-tag from ''E. coli'', in [SW|pWH844]), available in [SW|Jörg Stülke]'s lab

References

• 18083814,12618455,20935095,18763711,21097623,21699902,25645558,25777134,29416041