SubtiBank SubtiBank
yxiT/1
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yxiT/1

part of the yxiT pseudogene
locus
BSU_39029
pI
0.00
mw
0.00 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    Coordinates
    4,006,987 4,007,415

    Biological materials

    Mutant

  • BKE39029 ([gene|20ECFC7380C773ABD230567C0BC085B73AFD4E32|yxiT/1]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39029 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCGCCTGCTTTTTTG, downstream forward: _UP4_TAATGAAAAGAGCCATATCC
  • BKK39029 ([gene|20ECFC7380C773ABD230567C0BC085B73AFD4E32|yxiT/1]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39029 BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCGCCTGCTTTTTTG, downstream forward: _UP4_TAATGAAAAGAGCCATATCC