SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


part of the yxiT pseudogene
0.00 kDa
protein length
142 aa Sequence Blast
gene length
429 bp Sequence Blast

Genomic Context



  • [category|SW 6|Groups of genes] → [category|SW 6.10|Pseudogenes]
  • Gene

    4,006,987 4,007,415

    Biological materials


  • BKE39029 ([gene|20ECFC7380C773ABD230567C0BC085B73AFD4E32|yxiT/1]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCGCCTGCTTTTTTG, downstream forward: _UP4_TAATGAAAAGAGCCATATCC
  • BKK39029 ([gene|20ECFC7380C773ABD230567C0BC085B73AFD4E32|yxiT/1]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_GCTGTTCGCCTGCTTTTTTG, downstream forward: _UP4_TAATGAAAAGAGCCATATCC