SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


cytochrome-c oxidase (subunit I)
68.93 kDa
protein length
622 aa Sequence Blast
gene length
1869 bp Sequence Blast
cytochrome-c oxidase (subunit I)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.2|Respiration] → [category|SW|Terminal oxidases]
  • [category|SW 6|Groups of genes] → [category|SW 6.11|Efp-dependent proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,561,569 1,563,437

    Phenotypes of a mutant

  • essential according to [Pubmed|17114254], non-essential according to [Pubmed|10551842]
  • The protein

    Catalyzed reaction/ biological activity

  • 4 [Fe(II)cytochrome c] + 4 H+ + O2 --> 4 [Fe(III)cytochrome c] + 2 H2O (according to UniProt)
  • Protein family

  • heme-copper respiratory oxidase family (with [protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|QoxB], according to UniProt)
  • Paralogous protein(s)

  • [protein|CBF2DCFFD8195304F942ECBA8596444F0AC47CC6|QoxB]
  • [SW|Cofactors]

  • 2 heme A molecules, Cu(B) [Pubmed|10837475]
  • Structure

  • [PDB|1FFT] (the protein from E. coli, 44% identity) [pubmed|11017202]
  • [SW|Localization]

  • cell membrane (according to Swiss-Prot)
  • Expression and Regulation



    regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [Pubmed|9829923], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh]: repression, synergistic repression with [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB], in [regulon|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, synergistic repression with [protein|5872812AB61E92E2944E926915EB7FEE71BFA6D5|Abh], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]) [Pubmed|9829923]
  • view in new tab

    additional information

  • [protein|search|translation] is likely to require [protein|3054CD45713BBD69C2A528DE24AF6AF37175FD9D|Efp] due to the presence of several consecutive proline residues [PubMed|23239624,23239623]
  • Biological materials


  • BKE14900 ([gene|20D1174554A03EECE233A1A045F6DF83AF799959|ctaD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGACCTCCCCCAAT, downstream forward: _UP4_GATGATAAAGGGGTGAAGGC
  • BKK14900 ([gene|20D1174554A03EECE233A1A045F6DF83AF799959|ctaD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATGTGACCTCCCCCAAT, downstream forward: _UP4_GATGATAAAGGGGTGAAGGC
  • References

  • 1685007,10551842,9829923,17114254,20817675,10837475,27503613,11017202