SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


penicillin-binding protein 4A, D-alanyl-D-alanine carboxypeptidase
52.72 kDa
protein length
491 aa Sequence Blast
gene length
1476 bp Sequence Blast
penicillin-binding protein 4A, D-alanyl-D-alanine carboxypeptidase

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    1,998,340 1,999,815

    The protein

    Catalyzed reaction/ biological activity

  • cleavage ofD-Ala-D-Ala interpeptide bridges in peptidoglycan [Pubmed|19758330]
  • Preferential cleavage: (Ac)(2)-L-Lys-D-Ala-|-D-Ala. Also transpeptidation of peptidyl-alanyl moieties that are N-acyl substituents of D-alanine (according to UniProt)
  • Protein family

  • peptidase S13 family (single member, according to UniProt)
  • Structure

  • [PDB|1W5D] [pubmed|17582436]
  • [PDB|2J9P] (complex with a peptidoglycan mimetic peptide) [pubmed|17582436]
  • [SW|Localization]

  • during vegetative growth: distinct foci and bands at cell periphery [pubmed|14731276]
  • secreted, may be anchored in the membrane via a C-terminal amphiphatic alpha helix [pubmed|9733705]
  • Expression and Regulation



    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|9733705], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • [protein|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB]: sigma factor, [Pubmed|10482513], in [regulon|580011DE5DC40EC9E7E0512791D328FAA010DCB8|SigB regulon]
  • view in new tab

    Biological materials


  • MGNA-B075 (dacC::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE18350 ([gene|20A3120D2A45449745C9162EDCF386ED3163851B|dacC]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATTTCCCCGCCTCTC, downstream forward: _UP4_TAATAGCGGGAGACCTGTTT
  • BKK18350 ([gene|20A3120D2A45449745C9162EDCF386ED3163851B|dacC]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTAATTTCCCCGCCTCTC, downstream forward: _UP4_TAATAGCGGGAGACCTGTTT
  • GFP fusion

  • 3102 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 ([gene|DE4857E8A228F145EFB9B7AD817585258344ED1F|amyE]::Pxyl-gfp-[gene|20A3120D2A45449745C9162EDCF386ED3163851B|dacC]1-1473 spc) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • 3104 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|20A3120D2A45449745C9162EDCF386ED3163851B|dacC]::pSG5044 (cat Pxyl-gfpa-[gene|20A3120D2A45449745C9162EDCF386ED3163851B|dacC]1-615) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • References


  • 18266855
  • Original publications

  • 9733705,10482513,19758330,14731276,17582436,9864321,21821766,22029692,23560856,26460848