SubtiBank SubtiBank
clsA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

clsA

cardiolipin synthase, major enzyme
locus
BSU_36590
pI
9.55
mw
55.70 kDa
protein length
482 aa Sequence Blast
gene length
1449 bp Sequence Blast
function
biosynthesis of phospholipids
product
cardiolipin synthase, major enzyme
essential
no
synonyms
ywnE

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW 2.4.2.2|Biosynthesis of phospholipids]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,762,664 3,764,112

    Phenotypes of a mutant

  • increased conjugation of ICEBs1 [Pubmed|26833415]
  • The protein

    Catalyzed reaction/ biological activity

  • 2 1,2-diacyl-sn-glycero-3-phospho-(1'-sn-glycerol) --> cardiolipin + glycerol (according to UniProt)
  • Protein family

  • phospholipase D family (with [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE] and [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE], according to UniProt)
  • Paralogous protein(s)

  • [protein|B63AAF0D3277FD776944A09D2546F3E48C8716AD|YwjE], [protein|07752EC6940F43DEBD1E9313A2A195E35EDB9F69|YwiE]
  • [SW|Localization]

  • cell membrane at the septum, this localization depends on two C-terminal helices [Pubmed|26708983,15743965]
  • Expression and Regulation

    Operons

    genes
    [gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE36590 ([gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGTAACCCCGCTCAT, downstream forward: _UP4_TAAGATGCGTAAACCCCCGG
  • BKK36590 ([gene|2079B210322F26EEC3CCF55611622FADDB1D1BC7|clsA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36590 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTTGTAACCCCGCTCAT, downstream forward: _UP4_TAAGATGCGTAAACCCCCGG
  • References

  • 18820022,14973018,16514141,15743965,26708983,26833415,28376879