SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


Viral quorum sensor, Phage SPbeta lysogeny promoter
4.08 kDa
protein length
gene length
126 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    2,208,855 2,208,980

    The protein

    Catalyzed reaction/ biological activity

  • Proteolytically cleaved in extracellular space to yield hexapeptide (GMPRGA) regulator. Hexapeptide re-enters cells and binds to [protein|CAE7D8E45DA7CDE99D3EA114DF7E368A0A126389|AimR] to promote SPbeta lysogeny. ([Pubmed|31149347])
  • Structure

  • Hexapeptide bound to [protein|CAE7D8E45DA7CDE99D3EA114DF7E368A0A126389|AimR]: [PDB|5Y24] ([Pubmed|30224798]), [PDB|5ZW6] ([Pubmed|30323253]), [PDB|6IM4] ([Pubmed|30421358]), [PDB|6HP5] ([Pubmed|30745087]), [PDB|6JG9] ([Pubmed|31149347])
  • Expression and Regulation



    regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: transcription repression [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • view in new tab

    Biological materials


  • BKE20850 ([gene|20735BFECA52826F0F4D55843EEE7798F414993C|aimP]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTCACCTCCTTTAA, downstream forward: _UP4_TAAAATCCATTGACACATAA
  • BKK20850 ([gene|20735BFECA52826F0F4D55843EEE7798F414993C|aimP]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTGTCTCACCTCCTTTAA, downstream forward: _UP4_TAAAATCCATTGACACATAA
  • References

  • 12850135,12850135,20525796,30224798,30323253,30421358,30745087,31149347