SubtiBank SubtiBank
tcyA
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

tcyA

cystine and diaminopimelate [SW|ABC transporter] (binding protein)
locus
BSU03610
pI
9.12
mw
29.32 kDa
protein length
268 aa Sequence Blast
gene length
807 bp Sequence Blast
function
cystine uptake
product
cystine and diaminopimelate [SW|ABC transporter] (binding protein)
essential
no
synonyms
yckK

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.2|Uptake of amino acids]
  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.1|Biosynthesis/ acquisition of amino acids] → [category|SW 2.3.1.9|Biosynthesis/ acquisition of cysteine]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    410,656 411,462

    The protein

    Catalyzed reaction/ biological activity

  • uptake of cystine and diaminopimelate [pubmed|29995990]
  • Protein family

  • [SW|bacterial solute-binding protein 3 family] (according to UniProt)
  • Paralogous protein(s)

  • [protein|7050A2CC4BA2183C3CD22A246846CBCE43D73ABC|YckB]
  • Structure

  • [PDB|2YLN] (from Neisseria gonorrhoeae, 54% identity) [pubmed|22138345]
  • [SW|Localization]

  • attached to the membrane via [protein|9400DF25487461E3738DDDC72BDDB1589281409D|TcyB] [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]-[gene|9400DF25487461E3738DDDC72BDDB1589281409D|tcyB]-[gene|B453986691E1231A1C565D469A2A60EBFF2F6BD3|tcyC]
    description
    [Pubmed|22383849,15262924]

    regulation

  • strongly repressed in response to glucose starvation in M9 medium [Pubmed|23033921]
  • view in new tab

    Biological materials

    Mutant

  • BKE03610 ([gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE03610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCCCCACTTTTC, downstream forward: _UP4_GAAGATGTTTCTAAATAATC
  • BKK03610 ([gene|2056F8EEDF9D3027CFD808E8D0C5DF544DBDD3F3|tcyA]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK03610 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTATTCCCCACTTTTC, downstream forward: _UP4_GAAGATGTTTCTAAATAATC
  • References

  • 15262924,10092453,7551042,23033921,22138345,29995990