SubtiBank SubtiBank
lipB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

lipB

extracellular esterase, lipase
locus
BSU_08350
pI
9.68
mw
22.22 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
function
lipid degradation
product
extracellular esterase, lipase
essential
no
synonyms
yfiP

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW 2.4.1.4|Utilization of lipids/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    Coordinates
    910,019 910,651

    The protein

    Catalyzed reaction/ biological activity

  • triacylglycerol + H2O --> diacylglycerol + fatty acid + H+ (according to UniProt)
  • Protein family

  • [SW|AB hydrolase superfamily] (according to UniProt)
  • Paralogous protein(s)

  • [protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|Lip]
  • Structure

  • [PDB|2QXT] ([protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|Lip], 75% identity) [pubmed|18053819]
  • Expression and Regulation

    Operons

    genes
    [gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-C304 (lipB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2302 NBRP B. subtilis, Japan]
  • BKE08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA, downstream forward: _UP4_TAATATCTTCAAAAAACAAC
  • BKK08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08350 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA, downstream forward: _UP4_TAATATCTTCAAAAAACAAC
  • References

  • 12951259,11029590,11583117,10913700,18053819