SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


extracellular esterase, lipase
22.22 kDa
protein length
210 aa Sequence Blast
gene length
633 bp Sequence Blast
lipid degradation
extracellular esterase, lipase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.1|Utilization of lipids] → [category|SW|Utilization of lipids/ other]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    910,019 910,651

    The protein

    Paralogous protein(s)

  • [protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|Lip]
  • Structure

  • [PDB|2QXT] ([protein|0DB03F47C7AA45BF52653B1C0B2C5025960C53D7|Lip], 75% identity) [pubmed|18053819]
  • Expression and Regulation


    view in new tab

    Biological materials


  • MGNA-C304 (lipB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA, downstream forward: _UP4_TAATATCTTCAAAAAACAAC
  • BKK08350 ([gene|2053E27BE6837D2B167960C9B07C8B7B7BBABE25|lipB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTATTCCCCCAAAAA, downstream forward: _UP4_TAATATCTTCAAAAAACAAC
  • References

  • 12951259,11029590,11583117,10913700,18053819