SubtiBank SubtiBank
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.


acyl-carrier protein synthase, 4-phosphopantetheine transferase
13.58 kDa
protein length
121 aa Sequence Blast
gene length
363 bp Sequence Blast
fatty acid biosynthesis
acyl-carrier protein synthase

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.4|Lipid metabolism] → [category|SW 2.4.2|Biosynthesis of lipids] → [category|SW|Biosynthesis of fatty acids]
  • [category|SW 6|Groups of genes] → [category|SW 6.1|Essential genes]
  • Gene

    515,710 → 516,075

    Phenotypes of a mutant

  • essential [Pubmed|12682299]
  • The protein

    Catalyzed reaction/ biological activity

  • CoA-(4'-phosphopantetheine) + apo-[acyl-carrier-protein] = adenosine 3',5'-bisphosphate + holo-[acyl-carrier-protein] (according to Swiss-Prot)
  • Protein family

  • AcpS family (according to Swiss-Prot)
  • [SW|Cofactors]

  • magnesium [Pubmed|11489886]
  • Structure

  • [PDB|1F7T] [Pubmed|10997907], [PDB|1F80] (complex with [protein|8D260693D0C69442BCB9F3D8480E8425ACFE34D2|AcpA]) [Pubmed|10997907]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Biological materials


  • MGNA-C103 (ydcB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE04620 (Δ[gene|200BE4802FCE3C860565B374EAADC9C1FEEF3E49|acpS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTATGATAACCTCCTTT, downstream forward: _UP4_TAGTCTGCATATTAGGGAAA
  • References


  • 15952903
  • Original Publications

  • 11489886,15955059,10997907,11867633