SubtiBank SubtiBank
gerW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

gerW

germination protein
locus
BSU_29500
pI
4.99
mw
16.20 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
unknown
product
germination protein
essential
no
synonyms
ytfJ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,018,309 3,018,764

    Phenotypes of a mutant

  • no [SW|germination] in response to l-alanine [Pubmed|23921501], this has been disputed [Pubmed|25790435]
  • The protein

    Modification

  • phosphorylated on Arg-125 [pubmed|31221751]
  • [SW|Localization]

  • in the dormant spore [Pubmed|23921501]
  • Expression and Regulation

    Operons

    genes
    [gene|9F7A754B2867CED5CDF3F06009DF5DBDD0877BAF|ytfI]-[gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|23921501,16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A112 (ytfJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/112 NBRP B. subtilis, Japan]
  • BKE29500 ([gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGGTCTGCCATATACGCTT, downstream forward: _UP4_TAAAAAAAGGTTAACTGCGC
  • BKK29500 ([gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGGTCTGCCATATACGCTT, downstream forward: _UP4_TAAAAAAAGGTTAACTGCGC
  • References

  • 16497325,9387221,12107147,23921501,25790435,31221751