SubtiBank SubtiBank
gerW
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

gerW

germination protein
locus
BSU_29500
pI
4.99
mw
16.20 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
function
unknown
product
germination protein
essential
no
synonyms
ytfJ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW 4.2.4.2|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    3,018,309 3,018,764

    Phenotypes of a mutant

  • no [SW|germination] in response to l-alanine [Pubmed|23921501], this has been disputed [Pubmed|25790435]
  • The protein

    Modification

  • phosphorylated on Arg-125 [pubmed|31221751]
  • [SW|Localization]

  • in the dormant spore [Pubmed|23921501]
  • Expression and Regulation

    Operons

    genes
    [gene|9F7A754B2867CED5CDF3F06009DF5DBDD0877BAF|ytfI]-[gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]
    description
    [Pubmed|9387221]

    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|23921501,16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A112 (ytfJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/112 NBRP B. subtilis, Japan]
  • BKE29500 ([gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGGTCTGCCATATACGCTT, downstream forward: _UP4_TAAAAAAAGGTTAACTGCGC
  • BKK29500 ([gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29500 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGGTCTGCCATATACGCTT, downstream forward: _UP4_TAAAAAAAGGTTAACTGCGC
  • References

  • 16497325,9387221,12107147,23921501,25790435,31221751