SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


germination protein
16.20 kDa
protein length
151 aa Sequence Blast
gene length
456 bp Sequence Blast
germination protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.4|Germination] → [category|SW|Additional germination proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    3,018,309 3,018,764

    Phenotypes of a mutant

  • no [SW|germination] in response to l-alanine [Pubmed|23921501], this has been disputed [Pubmed|25790435]
  • The protein


  • phosphorylated on Arg-125 [pubmed|31221751]
  • [SW|Localization]

  • in the dormant spore [Pubmed|23921501]
  • Expression and Regulation



    sigma factors

  • [protein|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF]: sigma factor, [Pubmed|23921501,16497325], in [regulon|CFF318EE6CACDEE763FBF96A2ABB46E944679AAA|SigF regulon]
  • regulation

  • expressed early during sporulation in the forespore ([protein|search|SigF]) [Pubmed|16497325]
  • view in new tab

    Biological materials


  • MGNA-A112 (ytfJ::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE29500 ([gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGGTCTGCCATATACGCTT, downstream forward: _UP4_TAAAAAAAGGTTAACTGCGC
  • BKK29500 ([gene|1FDD81F50B0B0F260A638FECD9B92F8A5F5ED126|gerW]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGGTCTGCCATATACGCTT, downstream forward: _UP4_TAAAAAAAGGTTAACTGCGC
  • References

  • 16497325,9387221,12107147,23921501,25790435,31221751