SubtiBank SubtiBank
yocM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yocM

small heat-shock protein, protects cell during salt stress
locus
BSU_19260
pI
5.01
mw
18.34 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    2,098,316 2,098,792

    Phenotypes of a mutant

  • impaired survival after salt shock [pubmed|30431188]
  • The protein

    Protein family

  • [SW|small heat shock protein (Hsp20) family] (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-B417 (yocM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1416 NBRP B. subtilis, Japan]
  • BKE19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAAC
  • BKK19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAAC
  • References

  • 11150673,30431188