SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


small heat-shock protein, protects cell during salt stress
18.34 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    2,098,316 2,098,792

    Phenotypes of a mutant

  • impaired survival after salt shock [pubmed|30431188]
  • The protein

    Protein family

  • [SW|small heat shock protein (Hsp20) family] (according to UniProt)
  • [SW|Domains]

  • sHSP domain (aa 51-158) (according to UniProt)
  • Biological materials


  • MGNA-B417 (yocM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAAC
  • BKK19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAAC
  • References

  • 11150673,30431188