SubtiBank SubtiBank
yocM
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yocM

small heat-shock protein, protects cell during salt stress
locus
BSU19260
pI
5.01
mw
18.34 kDa
protein length
158 aa Sequence Blast
gene length
477 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.6|Coping with hyper-osmotic stress]
  • Gene

    Coordinates
    2,098,316 2,098,792

    Phenotypes of a mutant

  • impaired survival after salt shock [pubmed|30431188]
  • The protein

    Protein family

  • [SW|small heat shock protein (Hsp20) family] (according to UniProt)
  • Biological materials

    Mutant

  • MGNA-B417 (yocM::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1416 NBRP B. subtilis, Japan]
  • BKE19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAAC
  • BKK19260 ([gene|1FC88F6350BC721F0C554E878366B1BC171613E3|yocM]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19260 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTGAAGCCCCCTGTCTT, downstream forward: _UP4_GACGAAGGTCAAGCGAAAAC
  • References

  • 11150673,30431188