SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


similar to phage-related protein
13.15 kDa
protein length
118 aa Sequence Blast
gene length
357 bp Sequence Blast

Genomic Context



  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • Gene

    2,272,534 2,272,890

    The protein


  • extracellular (signal peptide) [Pubmed|18957862]
  • Expression and Regulation



    regulatory mechanism

  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|yolA]' and '[protein|search|yokL]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE21530 ([gene|1F99778502096A7EA726EB767E1BA5F0D1F770AB|yolB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTAGAAGTACTAATCACCT, downstream forward: _UP4_TAAATAATGAAAACAATGCC
  • BKK21530 ([gene|1F99778502096A7EA726EB767E1BA5F0D1F770AB|yolB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATTAGAAGTACTAATCACCT, downstream forward: _UP4_TAAATAATGAAAACAATGCC
  • References

  • 18957862,20817675