SubtiBank SubtiBank
yycS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yycS

unknown
locus
BSU_40240
pI
4.51
mw
15.68 kDa
protein length
137 aa Sequence Blast
gene length
414 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    4,135,351 4,135,764

    Expression and Regulation

    Operons

    genes
    [gene|1F947DFED973F22A139B0F501723B237BB8F2E33|yycS]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B815 (yycS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1814 NBRP B. subtilis, Japan]
  • BKE40240 ([gene|1F947DFED973F22A139B0F501723B237BB8F2E33|yycS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCAGACCTCCCCACA, downstream forward: _UP4_TAAAGCCGGCGTTCTGAGAA
  • BKK40240 ([gene|1F947DFED973F22A139B0F501723B237BB8F2E33|yycS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40240 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAAATGCAGACCTCCCCACA, downstream forward: _UP4_TAAAGCCGGCGTTCTGAGAA