SubtiBank SubtiBank
mraW
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

mraW

S-adenosyl-L-methionine-dependent methyltransferase
locus
BSU_15140
pI
6.03
mw
35.15 kDa
protein length
311 aa Sequence Blast
gene length
936 bp Sequence Blast
function
unknown
product
S-adenosyl-L-methionine-dependent methyltransferase
essential
no
ec
2.1.1.199
synonyms
yllC,ylxA

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    1,580,622 1,581,557

    The protein

    Catalyzed reaction/ biological activity

  • cytidine1402 in 16S rRNA + S-adenosyl-L-methionine --> H+ + N4-methylcytidine1402 in 16S rRNA + S-adenosyl-L-homocysteine (according to UniProt)
  • Protein family

  • [SW|Methyltransferase superfamily] (according to UniProt)
  • Structure

  • [PDB|1N2X] (from ''Thermotoga maritima'', 41% identity, 70% similarity) [Pubmed|12824489]
  • [PDB|3TKA] (from ''Escherichia Coli'', 46% identity)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|A7131ACFA0CF5C222237C76E502D4AAD1F9BA3E4|mraZ]-[gene|1F894D6895CE13AA006CFE13A702E46C568F6E79|mraW]-[gene|79712F4CF884A660C71B45B3397AEFA5C0AFA683|ftsL]-[gene|EBEFF9E0A524DCDA19382E5401B923B805E4C559|pbpB]
    description
    [Pubmed|8636036,8244929]

    regulation

  • constitutively expressed [Pubmed|15758244]
  • view in new tab

    additional information

  • the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • Biological materials

    Mutant

  • MGNA-B130 (ylxA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1129 NBRP B. subtilis, Japan]
  • 1A818 ( ''mraW''::''erm''), [Pubmed|12682299], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A818&Search=1A818 BGSC]
  • BKE15140 ([gene|1F894D6895CE13AA006CFE13A702E46C568F6E79|mraW]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGTTGGTCCCACC, downstream forward: _UP4_TAACGAAACGCGAACGCAAA
  • BKK15140 ([gene|1F894D6895CE13AA006CFE13A702E46C568F6E79|mraW]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15140 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTGTGTTGGTCCCACC, downstream forward: _UP4_TAACGAAACGCGAACGCAAA
  • References

  • 8636036,12824489,26883633