SubtiBank SubtiBank
rapF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rapF

response regulator aspartate phosphatase, anti-activator protein, controls [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
locus
BSU_37460
pI
5.18
mw
45.45 kDa
protein length
381 aa Sequence Blast
gene length
1146 bp Sequence Blast
function
control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity
product
response regulator aspartate phosphatase
essential
no
synonyms
ywhJ

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
  • [category|SW 3|Information processing] → [category|SW 3.3|Protein synthesis, modification and degradation] → [category|SW 3.3.4|Protein modification] → [category|SW 3.3.4.4|Protein phosphatases]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.2|Control of two-component response regulators] → [category|SW 3.4.2.2.2|Response regulator aspartate phosphatase]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.8|Quorum sensing]
  • [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
  • Gene

    Coordinates
    3,846,001 3,847,146

    The protein

    Catalyzed reaction/ biological activity

  • control of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] activity [Pubmed|15968044]
  • Protein family

  • [SW|RAP family] (according to UniProt)
  • [SW|Domains]

  • six [SW|TPR repeat|tetratrichopeptide repeats] (according to UniProt)
  • Effectors of protein activity

  • binding of [protein|AEBEDF43C56A9A54716D781D062067B69818FAF4|PhrF] to [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF] results in a conformational change of [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF] and prevents it from binding [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] [Pubmed|15968044,22215984]
  • Structure

  • [PDB|3ULQ] (structure of the complex between the DNA-binding C-terminal domain of [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA] with [protein|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|RapF]) [Pubmed|22215984]
  • Expression and Regulation

    Operons

    genes
    [gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]-[gene|AEBEDF43C56A9A54716D781D062067B69818FAF4|phrF]
    description
    [Pubmed|11466295]

    sigma factors

  • [protein|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH]: sigma factor, [Pubmed|11466295], in [regulon|DC3449D5F195E5C2E9E14FEC95396C8F1FDF73B4|SigH regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA]: activation, [Pubmed|15968044], in [regulon|7832489F11F606BCF637EC23BAAB41AD10237EBB|ComA regulon]
  • regulation

  • PhrF accumulates at high cell density
  • view in new tab

    Biological materials

    Mutant

  • MGNA-A035 (rapF::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/35 NBRP B. subtilis, Japan]
  • BKE37460 ([gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE37460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTGCAAATCCCTCCC, downstream forward: _UP4_CTTATTCAAGGAGGAGTGAG
  • BKK37460 ([gene|1F860F4E66A3D503D5A97F17D4AB0504BEFE7F9D|rapF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK37460 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTTTGCAAATCCCTCCC, downstream forward: _UP4_CTTATTCAAGGAGGAGTGAG
  • References

  • 12850135,15968044,11466295,16091051,22215984