SubtiBank SubtiBank
ydjO
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

ydjO

unknown
locus
BSU_06270
pI
7.64
mw
7.71 kDa
protein length
gene length
210 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    681,255 681,464

    The protein

    Modification

  • phosphorylated on Arg-7 [Pubmed|22517742]
  • additional information

  • [protein|1F845CE702BCD10F4DB596E438CE9DB076806B1D|YdjO] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|D30ADD18D86E153482FE2BFC621230FEE5912BF9|yeaA]-[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]-[gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • induced by cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C222 (ydjO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2220 NBRP B. subtilis, Japan]
  • BKE06270 ([gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGTCACTTCTTCCCT, downstream forward: _UP4_TAGTTCTTCCCTATAACAAA
  • BKK06270 ([gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGTCACTTCTTCCCT, downstream forward: _UP4_TAGTTCTTCCCTATAACAAA
  • References

  • 9987136,12399512,22517742,21710567