SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


7.71 kDa
protein length
gene length
210 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    681,255 681,464

    The protein


  • phosphorylated on Arg-7 [Pubmed|22517742]
  • additional information

  • [protein|1F845CE702BCD10F4DB596E438CE9DB076806B1D|YdjO] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation



    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • induced by cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials


  • MGNA-C222 (ydjO::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE06270 ([gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGTCACTTCTTCCCT, downstream forward: _UP4_TAGTTCTTCCCTATAACAAA
  • BKK06270 ([gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGTCACTTCTTCCCT, downstream forward: _UP4_TAGTTCTTCCCTATAACAAA
  • References

  • 9987136,12399512,22517742,21710567