SubtiBank SubtiBank
ydjO
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

ydjO

unknown
locus
BSU_06270
pI
7.64
mw
7.71 kDa
protein length
gene length
210 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.5|Cold stress proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
  • Gene

    Coordinates
    681,255 681,464

    The protein

    Modification

  • phosphorylated on Arg-7 [Pubmed|22517742]
  • additional information

  • [protein|1F845CE702BCD10F4DB596E438CE9DB076806B1D|YdjO] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • Expression and Regulation

    Operons

    genes
    [gene|D30ADD18D86E153482FE2BFC621230FEE5912BF9|yeaA]-[gene|322BE299860795A70EFA78B8E2614CCCC1CE7C87|ydjP]-[gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]
    description
    [Pubmed|9987136]

    sigma factors

  • [protein|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW]: sigma factor, [Pubmed|9987136], in [regulon|3D974DD2967C7F8FD4E3C2AF42617B8AE9F0296D|SigW regulon]
  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • induced by cold shock [Pubmed|12399512]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C222 (ydjO::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2220 NBRP B. subtilis, Japan]
  • BKE06270 ([gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE06270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGTCACTTCTTCCCT, downstream forward: _UP4_TAGTTCTTCCCTATAACAAA
  • BKK06270 ([gene|1F845CE702BCD10F4DB596E438CE9DB076806B1D|ydjO]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK06270 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAGTCACTTCTTCCCT, downstream forward: _UP4_TAGTTCTTCCCTATAACAAA
  • References

  • 9987136,12399512,22517742,21710567