SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


inner spore coat protein
30.00 kDa
protein length
262 aa Sequence Blast
gene length
789 bp Sequence Blast
protection of the spore
spore coat protein

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Spore coat proteins] → [category|SW|Class IV]
  • Gene

    4,176,900 4,177,688

    The protein


  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    (according to [ DBTBS]) null


  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials


  • MGNA-B845 (yybI::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE40630 ([gene|1F816B8AB5BDF47C5D10D0AF25A62421E300509E|yybI]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTGTCACCTTCCCTA, downstream forward: _UP4_TAAGTATTCTTTCGATGCAG
  • BKK40630 ([gene|1F816B8AB5BDF47C5D10D0AF25A62421E300509E|yybI]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTGTCACCTTCCCTA, downstream forward: _UP4_TAAGTATTCTTTCGATGCAG
  • References

  • 15699190,12662922,22171814