SubtiBank SubtiBank
yybI
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yybI

inner spore coat protein
locus
BSU_40630
pI
5.91
mw
30.00 kDa
protein length
262 aa Sequence Blast
gene length
789 bp Sequence Blast
function
protection of the spore
product
spore coat protein
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.1|Spore coat proteins] → [category|SW 4.2.1.1.4|Class IV]
  • Gene

    Coordinates
    4,176,900 4,177,688

    The protein

    [SW|Localization]

  • inner spore coat, localization depends on [protein|CEBEC9CECCF445C40D793E61A2CD23175631A473|SafA] [Pubmed|22171814]
  • Expression and Regulation

    Operons

    genes
    [gene|1F816B8AB5BDF47C5D10D0AF25A62421E300509E|yybI]
    description
    [Pubmed|12662922]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    genes
    [gene|6B3A8F70CF308F69455CCE3A471566DED4C16383|yybH]-[gene|1F816B8AB5BDF47C5D10D0AF25A62421E300509E|yybI]
    description
    (according to [http://dbtbs.hgc.jp/COG/prom/yybHI.html DBTBS]) null

    regulation

  • expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B845 (yybI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1844 NBRP B. subtilis, Japan]
  • BKE40630 ([gene|1F816B8AB5BDF47C5D10D0AF25A62421E300509E|yybI]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE40630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTGTCACCTTCCCTA, downstream forward: _UP4_TAAGTATTCTTTCGATGCAG
  • BKK40630 ([gene|1F816B8AB5BDF47C5D10D0AF25A62421E300509E|yybI]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK40630 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTGTGTCACCTTCCCTA, downstream forward: _UP4_TAAGTATTCTTTCGATGCAG
  • References

  • 15699190,12662922,22171814