SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


proline dehydrogenase (L-proline, NAD)
34.89 kDa
protein length
303 aa Sequence Blast
gene length
912 bp Sequence Blast
proline utilization
proline dehydrogenase (L-proline, NAD)

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.3|Amino acid/ nitrogen metabolism] → [category|SW 2.3.2|Utilization of amino acids] → [category|SW|Utilization of proline]
  • Gene

    344,551 345,462

    Phenotypes of a mutant

  • no growth with proline as single source of carbon or nitrogen [Pubmed|21840319]
  • inactivation of ''[gene|1F548515402950572E7212901729B2480432D1B9|putB]'' eliminates sporulation [Pubmed|26735940]
  • The protein

    Catalyzed reaction/ biological activity

  • quinone + L-proline --> (S)-1-pyrroline-5-carboxylate + quinol + H+ (according to UniProt)
  • Protein family

  • proline dehydrogenase family (with [protein|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|FadM], according to UniProt)
  • Paralogous protein(s)

  • [protein|F8C51A86268DC6B2152B139D2D0B25CC3D69A5D5|FadM]
  • [SW|Cofactors]

  • FAD (according to UniProt)
  • Structure

  • [PDB|4H6Q] (from ''Deinococcus radiodurans '', 42% identity) [Pubmed|23151026]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|21840319,21964733,22139509], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR]: activation, [Pubmed|21840319,21964733,22139509], in [regulon|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR regulon]
  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY]: repression, displacement of [protein|C37D1CCBDE6DCEAB0AFACF8CBB3F733FE08324EE|PutR] [Pubmed|21840319], in [regulon|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|CodY regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • additional information

  • overexpressed in a [gene|64C6D783FF3F41C81B216F798A1DC8071345B1ED|pnpA] mutant [PubMed|14976255]
  • the [gene|B3DF99B747D0A7472E3878920BF3CE7CE954B0BE|putP] part of the mRNA is cleaved by [protein|BAB297D18F94FFA67B8D12A684AB4D1BCDFB4981|RNase III] [PubMed|26883633]
  • view in new tab

    Biological materials


  • MGNA-B992 (ycgM::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE03200 ([gene|1F548515402950572E7212901729B2480432D1B9|putB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCCAACCTCAACACCC, downstream forward: _UP4_AAGAAGTAAAAAAGGAGAGA
  • BKK03200 ([gene|1F548515402950572E7212901729B2480432D1B9|putB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTTCCAACCTCAACACCC, downstream forward: _UP4_AAGAAGTAAAAAAGGAGAGA
  • References

  • 14976255,21840319,14651647,12618455,23033921,21964733,22139509,23151026,26735940