SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


penicillin-binding protein X
43.70 kDa
protein length
391 aa Sequence Blast
gene length
1176 bp Sequence Blast
penicillin-binding protein X

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.1|Cell wall synthesis] → [category|SW|Penicillin-binding proteins]
  • [category|SW 4|Lifestyles] → [category|SW 4.3|Coping with stress] → [category|SW 4.3.2|Cell envelope stress proteins (controlled by SigM, V, W, X, Y)]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    1,765,859 1,767,034

    Phenotypes of a mutant

  • increased sensitivity to lysozyme [Pubmed|21856855]
  • inactivation of ''[gene|1F2062E59607706FE26A22876544F91B3B13179E|pbpX]'' strongly restores beta-lactam resistance in a ''[gene|081DF3EE9FA56209D648C7677188C61CE3AA8E41|sigM]'' mutant [Pubmed|22211522]
  • The protein

    Protein family

  • [SW|beta-lactamase family] (according to UniProt)
  • Structure

  • [PDB|3TG9] (a PBP from B. halodurans, aa 90-375, 28% identity)
  • [SW|Localization]

  • extracellular (signal peptide) [Pubmed|18957862]
  • during vegetative growth: septal, low flourescence at periphery [pubmed|14731276]
  • during sporulation: both asymmetric septa and the prespore [pubmed|15758244]
  • Expression and Regulation



    sigma factors

  • [protein|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM]: sigma factor, [Pubmed|18179421], in [regulon|081DF3EE9FA56209D648C7677188C61CE3AA8E41|SigM regulon]
  • [protein|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX]: sigma factor, [Pubmed|14762009,15758244], in [regulon|E77364F274A520FCCA9F5C9504E317B047BA29E6|SigX regulon]
  • [protein|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV]: sigma factor, [Pubmed|21926231], in [regulon|D04629D798E458AD538809BB2B150B7FA81D2C7E|SigV regulon]
  • regulation

  • expression is reduced in a [protein|search|SigV] mutant [Pubmed|21926231]
  • view in new tab

    Biological materials


  • MGNA-B074 (pbpX::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE16950 ([gene|1F2062E59607706FE26A22876544F91B3B13179E|pbpX]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTTCCTCCCAA, downstream forward: _UP4_TGATTGGCGATCTTCTTTTG
  • BKK16950 ([gene|1F2062E59607706FE26A22876544F91B3B13179E|pbpX]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCATTTTTTCCTCCCAA, downstream forward: _UP4_TGATTGGCGATCTTCTTTTG
  • GFP fusion

  • 3107 [gene|0467447B10EE7C1FDF86022AB6FBDBABFD32A9E5|trpC]2 [gene|1F2062E59607706FE26A22876544F91B3B13179E|pbpX]::pSG5047 (cat Pxyl-gfpa-[gene|1F2062E59607706FE26A22876544F91B3B13179E|pbpX]1-426) [pubmed|14731276], available in [SW|Dirk Jan Scheffers]' lab and in the [ BGSC]
  • References

  • 14762009,18957862,18179421,21856855,21926231,22211522,14731276