SubtiBank SubtiBank
iolJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

iolJ

2-deoxy-5-keto-gluconic acid-6-phosphate aldolase, formation of dihydroxyacetone phosphate and malonic semialdehyde (6th reaction)
locus
BSU39670
pI
4.85
mw
31.22 kDa
protein length
290 aa Sequence Blast
gene length
873 bp Sequence Blast
function
myo-inositol catabolism
product
2-deoxy-5-keto-gluconic acid-6-phosphate aldolase, formation of dihydroxyacetone phosphate and malonic semialdehyde (6th reaction)
essential
no
ec
4.1.2.29
synonyms
fbaB,yxdI

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.16|Utilization of inositol]
  • Gene

    Coordinates
    4,073,081 4,073,953

    The protein

    Catalyzed reaction/ biological activity

  • 5-dehydro-2-deoxy-D-gluconate 6-phosphate = glycerone phosphate + malonate semialdehyde (according to Swiss-Prot)
  • Protein family

  • IolJ subfamily (according to Swiss-Prot)
  • Paralogous protein(s)

  • [protein|800EC1F1CA8C4F2A643EDECBB684347C29CAB0CA|FbaA]
  • Effectors of protein activity

  • inhibited by alpha-keto acids [Pubmed|24624]
  • Structure

  • [PDB|4TO8] (from Staphylococcus aureus, 56% identity) [pubmed|25390935]
  • Expression and Regulation

    Operons

    genes
    [gene|762718A15E5256261D79DF60F9106AF0CE2D60C6|iolA]-[gene|0903CCBE053230998A9123F3269868E952C0F76B|iolB]-[gene|AAE60753464EAA32379521531FDCAF64534D5F40|iolC]-[gene|AA79B6F039EC5B79F4419A5F358AE5AE8292E731|iolD]-[gene|C31AF6C8050D453D9011B0793403791F1851BA69|iolE]-[gene|14813DE6C6DF7AB031BA05AED7D31AE9E8F8498E|iolF]-[gene|93C1DF93CAFC5AE726523A91A3BA7470017FF6DC|iolG]-[gene|FD64E9D00BB03B510C7F7CA3935558A2195532A9|iolH]-[gene|2742FCE60AA87B2BE5A0B5C34F617E10DDE7F126|iolI]-[gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]
    description
    [Pubmed|9226270]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|9226270], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR]: repression, [Pubmed|9887260,9226270], in [regulon|5F4ABBC8ECAD6F6C10EC39B2B0F0BC73F11522CE|IolR regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|10666464], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • induced by inositol ([protein|search|IolR]) [Pubmed|9887260,9226270]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B701 (iolJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1700 NBRP B. subtilis, Japan]
  • BKE39670 ([gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE39670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCACCCCTCCTTTAT, downstream forward: _UP4_TAAAGAGACCAGAAACCGCC
  • BKK39670 ([gene|1EFB5C8F28146D1EA3B615F548D0CF262D2B4DF5|iolJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK39670 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATATTCACCCCTCCTTTAT, downstream forward: _UP4_TAAAGAGACCAGAAACCGCC
  • labs

  • [SW|Yasutaro Fujita], University of Fukuyama, Japan
  • [[Ken-ichi Yoshida]], Kobe University, Japan
  • References

  • 9226270,18310071,9887260,18310071,25390935