SubtiBank SubtiBank
yodL
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.

yodL

modulator of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] activity
locus
BSU_19640
pI
9.88
mw
12.05 kDa
protein length
105 aa Sequence Blast
gene length
315 bp Sequence Blast
function
control of [SW|cell division]
product
modulator of [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] activity
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,136,538 → 2,136,852

    Phenotypes of a mutant

  • overexpression results in loss of cell width and cell lysis (suppressed by mutations in [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] that affect the interaction surface for [protein|6071A84EF190C820DB8985C08ABC74F744B793DB|RodZ]) [Pubmed|27215790]
  • Expression and Regulation

    Operons

    genes
    [gene|1EF303EA929237C2BD7A4507AFB248B800517B9F|yodL]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|27215790], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed early during [SW|sporulation] ([SW|Spo0A]) [Pubmed|27215790]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B440 (yodL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1439 NBRP B. subtilis, Japan]
  • BKE19640 (Δ[gene|1EF303EA929237C2BD7A4507AFB248B800517B9F|yodL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGATCCCCTCCCTTT, downstream forward: _UP4_TAATGAAAAGAAAACTGCGG
  • BKK19640 (Δ[gene|1EF303EA929237C2BD7A4507AFB248B800517B9F|yodL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGATCCCCTCCCTTT, downstream forward: _UP4_TAATGAAAAGAAAACTGCGG
  • References

  • 27215790,22383849