SubtiBank SubtiBank
yodL
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yodL

modulator of MreB activity
locus
BSU_19640
pI
9.88
mw
12.05 kDa
protein length
105 aa Sequence Blast
gene length
315 bp Sequence Blast
function
control of cell division
product
modulator of MreB activity
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.1|Cell envelope and cell division] → [category|SW 1.1.8|Cell division] → [category|SW 1.1.8.2|Other genes]
  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.5|Newly identified sporulation proteins (based on transcription profiling)]
  • Gene

    Coordinates
    2,136,538 → 2,136,852

    Phenotypes of a mutant

  • overexpression results in loss of cell width and cell lysis (suppressed by mutations in [protein|A4C8719E06F774A6EB4D79757CC79CF89E453A54|MreB] that affect the interaction surface for [protein|6071A84EF190C820DB8985C08ABC74F744B793DB|RodZ]) [Pubmed|27215790]
  • Expression and Regulation

    Operons

    genes
    [gene|1EF303EA929237C2BD7A4507AFB248B800517B9F|yodL]
    description
    [Pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|27215790], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • expressed early during [SW|sporulation] ([SW|Spo0A]) [Pubmed|27215790]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B440 (yodL::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1439 NBRP B. subtilis, Japan]
  • BKE19640 (Δ[gene|1EF303EA929237C2BD7A4507AFB248B800517B9F|yodL]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE19640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGATCCCCTCCCTTT, downstream forward: _UP4_TAATGAAAAGAAAACTGCGG
  • BKK19640 (Δ[gene|1EF303EA929237C2BD7A4507AFB248B800517B9F|yodL]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK19640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAAGATCCCCTCCCTTT, downstream forward: _UP4_TAATGAAAAGAAAACTGCGG
  • References

  • 27215790,22383849