SubtiBank SubtiBank
yfhS
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yfhS

sporulation gene
locus
BSU_08640
pI
5.84
mw
8.66 kDa
protein length
gene length
225 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    936,773 936,997

    Expression and Regulation

    Operons

    genes
    [gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]
    description
    [Pubmed|10463184]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [pubmed|10463184], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-C323 (yfhS::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/2321 NBRP B. subtilis, Japan]
  • BKE08640 ([gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE08640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAAGACCCCCTTT, downstream forward: _UP4_CGCGTCTCTTACGATTAAGA
  • BKK08640 ([gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK08640 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAAGACCCCCTTT, downstream forward: _UP4_CGCGTCTCTTACGATTAAGA
  • References

  • 10463184,18840696