SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


sporulation gene
8.66 kDa
protein length
gene length
225 bp Sequence Blast

Genomic Context



  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW|Sporulation proteins/ other]
  • Gene

    936,773 936,997

    Expression and Regulation



    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, [pubmed|10463184], in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • view in new tab

    Biological materials


  • MGNA-C323 (yfhS::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE08640 ([gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAAGACCCCCTTT, downstream forward: _UP4_CGCGTCTCTTACGATTAAGA
  • BKK08640 ([gene|1ED2FAEDA370D5A1854934FA63119568D6243668|yfhS]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAACAGAAGACCCCCTTT, downstream forward: _UP4_CGCGTCTCTTACGATTAAGA
  • References

  • 10463184,18840696