SubtiBank SubtiBank
yugJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yugJ

similar to NADH-dependent butanol dehydrogenase
locus
BSU_31370
pI
5.22
mw
42.57 kDa
protein length
387 aa Sequence Blast
gene length
1164 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.6|Poorly characterized/ putative enzymes]
  • Gene

    Coordinates
    3,223,471 3,224,634

    The protein

    Protein family

  • iron-containing alcohol dehydrogenase family (with [protein|B90D4E798145F2AF3421DDC5AB6CD578E2E17900|GbsB] and [protein|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|YugK], according to UniProt)
  • Paralogous protein(s)

  • [protein|D81610C7CA2A92FCB1195591ACB613E7C1288F6B|YugK]
  • Structure

  • [PDB|1VLJ] (from Thermotoga maritima, 44% identity)
  • Expression and Regulation

    Operons

    genes
    [gene|1E951C2B640966643D5F081159522CD1C51942C8|yugJ]
    description
    [Pubmed|9274030]

    regulatory mechanism

  • [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx]: activation, [Pubmed|14597697,19575568], in [regulon|2C6386E9A63F410558D168798D077DF91590F454|Spx regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B549 (yugJ::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1548 NBRP B. subtilis, Japan]
  • BKE31370 ([gene|1E951C2B640966643D5F081159522CD1C51942C8|yugJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE31370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACATCTCCTCCTTAGA, downstream forward: _UP4_TAAAAAAAGGGGAAATAGCC
  • BKK31370 ([gene|1E951C2B640966643D5F081159522CD1C51942C8|yugJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK31370 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGACATCTCCTCCTTAGA, downstream forward: _UP4_TAAAAAAAGGGGAAATAGCC
  • References

    Reviews

  • 20924577
  • Original publications

  • 9274030
  • The corresponding protein in ''E. coli

  • 20543070,18211903