SubtiBank SubtiBank
resD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

resD

two-component response regulator ([SW|OmpR family]), regulation of aerobic and anaerobic respiration, activates expression of target genes in response to oxygen limitation
locus
BSU_23120
pI
5.63
mw
27.34 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
function
regulation of aerobic and anaerobic respiration
product
two-component response regulator ([SW|OmpR family])
essential
no
synonyms
ypxD

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.1|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    Coordinates
    2,417,181 2,417,903

    Phenotypes of a mutant

  • a ''resD'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
  • The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • Modification

  • phosphorylated by [protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|ResE] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|2OQR] (RegX3 from Mycobacterium tuberculosis, 37% identity) [pubmed|17942407]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • information on binding sites can be found in the [http://www.prodoric2.de/detail.php?acc=MX000009 PRODORIC2 database]
  • Expression and Regulation

    Operons

    genes
    [gene|5CD1E266B0EC82546A2AF19A05490DD4D04F812C|rluB]-[gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|22383849]
    view in new tab

    genes
    [gene|F7D869F77E2275110737EF658C58FA1BF742D73F|resA]-[gene|495721E4B8BF6FEC01E62E86339560F90776EED1|resB]-[gene|97FE84CF968596AC39D19EE2E43DA625147FD702|resC]-[gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|8631715]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
  • view in new tab

    genes
    [gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]-[gene|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|resE]
    description
    [Pubmed|8631715]

    regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [http://www.ncbi.nlm.nih.gov/sites/entrez/8631715,11222591 PubMed]
  • view in new tab

    Biological materials

    Mutant

  • BKE23120 ([gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE23120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCCTGCTTTC, downstream forward: _UP4_TATAAATTTGAGGTCGGCGC
  • BKK23120 ([gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK23120 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCCTGCTTTC, downstream forward: _UP4_TATAAATTTGAGGTCGGCGC
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [http://www.uic.edu/depts/bios/faculty/hulett/hulettm.shtml Homepage]
  • References

    Reviews

  • 23046954
  • Original publications

  • 8682783,15576792,16885274,16885456,11325953,10094672,17322317,8631715,9988472,10972837,10972836,9352926,16825793,8631715,11222591,9988472,21091510,22287527,21710567,24214949,27791134,26296725,28439033,17942407,28899391