SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


two-component response regulator ([SW|OmpR family]), regulation of aerobic and anaerobic respiration, activates expression of target genes in response to oxygen limitation
27.34 kDa
protein length
240 aa Sequence Blast
gene length
723 bp Sequence Blast
regulation of aerobic and anaerobic respiration
two-component response regulator ([SW|OmpR family])

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.1|Electron transport and ATP synthesis] → [category|SW 2.1.1|Regulators of electron transport]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW|Two-component system response regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.2|Phosphorylation on an Asp residue]
  • Gene

    2,417,181 2,417,903

    Phenotypes of a mutant

  • a ''resD'' point mutation has been isolated upon selction at low pressure [Pubmed|26296725]
  • The protein

    Protein family

  • [SW|OmpR family] of two-component response regulators
  • [SW|Domains]

  • [SW|Response regulatory domain] (aa 8-121) (according to UniProt)
  • Modification

  • phosphorylated by [protein|EA6790EF30D3DDB9670FE52DFD2C5083AB6A48E1|ResE] on an Asp residue
  • Effectors of protein activity

  • phosphorylation likely affects DNA-binding activity
  • Structure

  • [PDB|2OQR] (RegX3 from Mycobacterium tuberculosis, 37% identity) [pubmed|17942407]
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • additional information

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD] may interact with [SW|RNA polymerase] [pubmed|21710567]
  • information on binding sites can be found in the [ PRODORIC2 database]
  • Expression and Regulation


    view in new tab


    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|8631715], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD]: activation, [PubMed|8631715,11222591], in [regulon|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|ResD regulon]
  • [protein|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP]: activation, [Pubmed|9988472], in [regulon|638D6D2FCCA2A167EFED05CB4E60C2D78D5319AE|PhoP regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|16825793], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • expressed under anaerobic conditions ([protein|search|ResD]) [,11222591 PubMed]
  • view in new tab



  • expressed under anaerobic conditions ([protein|search|ResD]) [,11222591 PubMed]
  • view in new tab

    Biological materials


  • BKE23120 ([gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCCTGCTTTC, downstream forward: _UP4_TATAAATTTGAGGTCGGCGC
  • BKK23120 ([gene|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTTTTCCCCCTGCTTTC, downstream forward: _UP4_TATAAATTTGAGGTCGGCGC
  • labs

  • [SW|Marion Hulett], University of Illinois at Chicago, USA [ Homepage]
  • References


  • 23046954
  • Original publications

  • 8682783,15576792,16885274,16885456,11325953,10094672,17322317,8631715,9988472,10972837,10972836,9352926,16825793,8631715,11222591,9988472,21091510,22287527,21710567,24214949,27791134,26296725,28439033,17942407,28899391