SubtiBank SubtiBank
ytcD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytcD

[SW|MarR family|MarR/DUF24 family] transcription regulator
locus
BSU_29030
pI
7.76
mw
14.35 kDa
protein length
126 aa Sequence Blast
gene length
381 bp Sequence Blast
function
unknown
product
[SW|MarR family|MarR/DUF24 family] transcription regulator
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.6|Transcription factor/ other/ based on similarity]
  • Gene

    Coordinates
    2,968,260 2,968,640

    The protein

    Protein family

  • [SW|MarR family|MarR/DUF24 family]
  • Paralogous protein(s)

  • [protein|51B1913B59C1876CCED4A88414797B3A22BE4E3C|YdeP], [protein|73AFDF65BE89C0E2CC59AF2AF64C29BD99D785DF|YodB], [protein|91085DA5E71B88E533D2E1D1BFB53E908116C6AA|HypR], [protein|C57DDC9710CB557179B062F9C5D786DB02A3B5FC|YkvN], [protein|D9A187961CFB9496A6712E9E48AAD384357A3E1C|HxlR], [protein|E757C4B329A99E3D0C70C77437DF4DDA300CA5E7|YdzF]
  • [SW|Domains]

  • [SW|HTH hxlR-type domain] (aa 8-106) (according to UniProt)
  • Structure

  • [PDB|2HZT]
  • Expression and Regulation

    Operons

    genes
    [gene|1E74F0557FF9ECB404B6544831F4E0A162473423|ytcD]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-A120 (ytcD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/120 NBRP B. subtilis, Japan]
  • BKE29030 ([gene|1E74F0557FF9ECB404B6544831F4E0A162473423|ytcD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCCATTCTCCTCA, downstream forward: _UP4_TAAAGCATGAGGGCAGTCAG
  • BKK29030 ([gene|1E74F0557FF9ECB404B6544831F4E0A162473423|ytcD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATACAATCCATTCTCCTCA, downstream forward: _UP4_TAAAGCATGAGGGCAGTCAG