SubtiBank SubtiBank
yveF
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yveF

unknown
locus
BSU_34420
pI
10.06
mw
3.15 kDa
protein length
gene length
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,533,196 3,533,288

    Expression and Regulation

    Operons

    genes
    [gene|1E0BA378F14ADF03D613DA3BF3241C1ADE75075E|yveF]-[gene|1F56C126099E1D5241069E06477F277C12B20C58|yveG]-[gene|ECA64CB1E4BF8B6B0854B1B63C9E85A519059C6C|padC]
    description
    [Pubmed|18326577]

    regulatory mechanism

  • [protein|A7824EACE0C109C676A374FD21F59D671B703305|PadR]: repression, [Pubmed|18326577], in [regulon|A7824EACE0C109C676A374FD21F59D671B703305|PadR regulon]
  • regulation

  • induced by phenolic acid ([protein|search|PadR]) [Pubmed|18326577]
  • view in new tab

    Biological materials

    Mutant

  • BKE34420 ([gene|1E0BA378F14ADF03D613DA3BF3241C1ADE75075E|yveF]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE34420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGAACCACCTCACCTT, downstream forward: _UP4_TGATTCATTCCGATTCGTTC
  • BKK34420 ([gene|1E0BA378F14ADF03D613DA3BF3241C1ADE75075E|yveF]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK34420 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGAGAACCACCTCACCTT, downstream forward: _UP4_TGATTCATTCCGATTCGTTC
  • References

  • 18326577