SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


56.34 kDa
protein length
495 aa Sequence Blast
gene length
1488 bp Sequence Blast
arabinan degradation

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of arabinan/ arabinose/ arabitol]
  • Gene

    2,913,661 2,915,148

    The protein

    Catalyzed reaction/ biological activity

  • Hydrolysis of terminal non-reducing alpha-L-arabinofuranoside residues in alpha-L-arabinosides (according to UniProt)
  • Protein family

  • glycosyl hydrolase 51 family (with [protein|2B2629D275491A9F7031D5A99BAA001B011A765B|AbfA], according to UniProt)
  • Structure

  • [PDB|2VRQ] (from Thermobacillus xylanilyticus, 66% identity) [pubmed|18563919]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|14973026], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|A567466894AE9DE7CDE7816615433A37532297B5|AraR]: repression, [Pubmed|14973026], in [regulon|A567466894AE9DE7CDE7816615433A37532297B5|AraR regulon]
  • regulation

  • induced by arabinose ([protein|search|AraR]) [Pubmed|14973026]
  • additional information

  • A [protein|search|ncRNA] is predicted between '[protein|search|trxA]' and '[protein|search|abf2]' [PubMed|20525796]
  • view in new tab

    Biological materials


  • BKE28510 ([gene|1DF08A474E95909EAF68CF26D97DD49350ABEA89|abf2]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTCTGATCATTCCTT, downstream forward: _UP4_TAATCGCGCAAGAGCGCCGG
  • BKK28510 ([gene|1DF08A474E95909EAF68CF26D97DD49350ABEA89|abf2]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCCTCTGATCATTCCTT, downstream forward: _UP4_TAATCGCGCAAGAGCGCCGG
  • References

  • 14973026,18757805,20525796,22900538,18563919