SubtiBank SubtiBank
SAVE THE DATE! 21st International Conference on Bacilli and Gram-Positive Bacteria. Prague, Czech Republic, June 7-11, 2021.


[SW|ABC transporter] (ATP binding domain) for cobalamin
37.34 kDa
protein length
353 aa Sequence Blast
gene length
1062 bp Sequence Blast
uptake of cobalamin
[SW|ABC transporter] (ATP binding domain)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of cofactors]
  • [category|SW 2|Metabolism] → [category|SW 2.6|Additional metabolic pathways] → [category|SW 2.6.2|Biosynthesis of cofactors] → [category|SW|Biosynthesis/ acquisition of cobalamine (B12))]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,402,469 3,403,530

    The protein

    Protein family

  • [SW|Binding-protein-dependent transport system permease family] (according to UniProt)
  • [SW|FecCD subfamily] (according to UniProt)
  • Structure

  • [PDB|4R9U], the ''E. coli'' BtuC-BtuD complex, BtuC shares 40% identity, 71% similarity with YvrB, [Pubmed|25402482]
  • [SW|Localization]

  • cell membrane (according to UniProt)
  • Expression and Regulation



    regulatory mechanism

  • [regulon|B12 riboswitch|B12 riboswitch]: termination, upon binding of B12 [Pubmed|14704351], in [regulon|B12 riboswitch|B12 riboswitch]
  • regulation

  • expression is decreased in the presence of cobalamin (vitamin B12) ([SW|B12 riboswitch]) [Pubmed|14704351]
  • view in new tab

    Biological materials


  • MGNA-B044 (yvrB::erm), available at the [ NBRP B. subtilis, Japan]
  • BKE33170 ([gene|1DC4A3D7E93677B0EAD15F43C80E50FD98527EBC|yvrB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATGATATATGCGGCAT, downstream forward: _UP4_CATCGCGGGGGGAGAAGCTT
  • BKK33170 ([gene|1DC4A3D7E93677B0EAD15F43C80E50FD98527EBC|yvrB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_ACCAATGATATATGCGGCAT, downstream forward: _UP4_CATCGCGGGGGGAGAAGCTT
  • References

  • 10092453,25402482,14704351