SubtiBank SubtiBank
yqxJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqxJ

unknown
locus
BSU25880
pI
4.82
mw
14.20 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqdF

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,663,551 2,663,913

    Expression and Regulation

    Operons

    genes
    [gene|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|yqxI]-[gene|1DB308368D49129D9FCF1F137A350EFCDFA97618|yqxJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • BKE25880 ([gene|1DB308368D49129D9FCF1F137A350EFCDFA97618|yqxJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTACCAATTCAAATCACC, downstream forward: _UP4_TAAAGATAAGGACCAGCCAC
  • BKK25880 ([gene|1DB308368D49129D9FCF1F137A350EFCDFA97618|yqxJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTACCAATTCAAATCACC, downstream forward: _UP4_TAAAGATAAGGACCAGCCAC
  • References

  • 14651647,20817675,27766092