SubtiBank SubtiBank
yqxJ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yqxJ

unknown
locus
BSU_25880
pI
4.82
mw
14.20 kDa
protein length
120 aa Sequence Blast
gene length
363 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms
yqdF

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.3|Skin element]
  • Gene

    Coordinates
    2,663,551 2,663,913

    Expression and Regulation

    Operons

    genes
    [gene|6EA4D86FA1EA6388054A4D863EB576187CD5AEEE|yqxI]-[gene|1DB308368D49129D9FCF1F137A350EFCDFA97618|yqxJ]
    description
    [pubmed|22383849]

    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: activation, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|12850135], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: repression, [Pubmed|20817675], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials

    Mutant

  • BKE25880 ([gene|1DB308368D49129D9FCF1F137A350EFCDFA97618|yqxJ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE25880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTACCAATTCAAATCACC, downstream forward: _UP4_TAAAGATAAGGACCAGCCAC
  • BKK25880 ([gene|1DB308368D49129D9FCF1F137A350EFCDFA97618|yqxJ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK25880 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGTTACCAATTCAAATCACC, downstream forward: _UP4_TAAAGATAAGGACCAGCCAC
  • References

  • 14651647,20817675,27766092