SubtiBank SubtiBank
ytzD
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ytzD

unknown
locus
BSU_29430
pI
7.03
mw
9.12 kDa
protein length
gene length
135 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,011,555 3,011,689

    Biological materials

    Mutant

  • BKE29430 ([gene|1DB29BAD1408478484889C0D0A565FC7F24D04DE|ytzD]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE29430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCCTCCCATCATTA, downstream forward: _UP4_TAAGCTGTCTGTACAGGCAG
  • BKK29430 ([gene|1DB29BAD1408478484889C0D0A565FC7F24D04DE|ytzD]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK29430 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCTGCCTCCCATCATTA, downstream forward: _UP4_TAAGCTGTCTGTACAGGCAG