SubtiBank SubtiBank
yraE
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yraE

forespore-specific sporulation protein, similar to spore coat protein
locus
BSU26980
pI
5.07
mw
7.34 kDa
protein length
gene length
198 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.2|Spore coat protein/ based on similarity]
  • Gene

    Coordinates
    2,754,607 2,754,804

    Expression and Regulation

    Operons

    genes
    [gene|7D61DB3A298C253BBC1C7B3AE169F8AAAE4610BB|yraG]-[gene|30A4306899B586898BC5B3666AD43D9DEE0579E1|yraF]-[gene|EA4CC0D36C39957DBBF9B1B11F65F33E8CD81FFE|adhB]-[gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]-[gene|0D99D9ECB3BCD6E3F58F8CE8E8CC5AF718C1ECD8|yraD]
    description
    [Pubmed|16497325]

    sigma factors

  • [protein|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG]: sigma factor, [Pubmed|16497325], in [regulon|5F24258282F3166B7696B9E9ABC1706E4D06C944|SigG regulon]
  • regulation

  • expressed during sporulation in the forespore ([protein|search|SigG]) [Pubmed|16497325]
  • view in new tab

    additional information

  • the mRNA belongs to the 46 most abundant mRNA species in dormant spores [pubmed|30782632]
  • Biological materials

    Mutant

  • BKE26980 ([gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE26980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATTTCTGTAACCTCCG, downstream forward: _UP4_CAAGAATGAGGAGATGAATA
  • BKK26980 ([gene|1D9D20DA24C13EF450710E8EDC5A36311DAF1BF0|yraE]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK26980 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TTCCATTTCTGTAACCTCCG, downstream forward: _UP4_CAAGAATGAGGAGATGAATA
  • References

  • 16497325,30782632