SubtiBank SubtiBank
yuxN
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yuxN

transcription repressor ([SW|TetR family])
locus
BSU_33030
pI
7.66
mw
33.16 kDa
protein length
291 aa Sequence Blast
gene length
876 bp Sequence Blast
function
control of [protein|2C6386E9A63F410558D168798D077DF91590F454|Spx] stability
product
transcription repressor
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 6|Groups of genes] → [category|SW 6.7|Proteins of unknown function]
  • Gene

    Coordinates
    3,388,113 3,388,988

    The protein

    [SW|Domains]

  • [SW|HTH tetR-type domain] (aa 2-62) (according to UniProt)
  • Expression and Regulation

    Operons

    genes
    [gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]
    description
    [Pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • MGNA-B208 (yuxN::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1207 NBRP B. subtilis, Japan]
  • BKE33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE33030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG, downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
  • BKK33030 ([gene|1D6C340264B8A75727E202AD2E37053091C94013|yuxN]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK33030 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATGGTTCCACCCTTTCGG, downstream forward: _UP4_TAGAAGAACGGCTGCTTAAA
  • References

  • 20525796,30001325