SubtiBank SubtiBank
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.


ribose [SW|ABC transporter] (binding protein)
32.07 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
ribose uptake
ribose [SW|ABC transporter] (binding protein)

Genomic Context



  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW|Importers] → [category|SW|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW|Utilization of ribose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    3,706,145 3,707,062

    The protein

    Protein family

  • bacterial solute-binding protein 2 family (single member, according to UniProt)
  • Structure

  • [PDB|2GX6] (from ''Escherichia coli k12 mutant'', 54% identity, 71% similarity)
  • [SW|Localization]

  • extracellular (signal peptide), lipid modification as retention signal [Pubmed|18957862]
  • attached to the cell membrane (via [protein|F1258E31151E137A850811B0C851D473CEFFD43B|RbsC]-[protein|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|RbsD]) [Pubmed|10092453]
  • Expression and Regulation



    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials


  • BKE35960 ([gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACCCTCCTAAGC, downstream forward: _UP4_TAATTGTCTGATGTTTAGGA
  • BKK35960 ([gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACCCTCCTAAGC, downstream forward: _UP4_TAATTGTCTGATGTTTAGGA
  • References

  • 10092453,16872404,7511775,7592460,18957862,7921236