SubtiBank SubtiBank
rbsB
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

rbsB

ribose [SW|ABC transporter] (binding protein)
locus
BSU35960
pI
6.14
mw
32.07 kDa
protein length
305 aa Sequence Blast
gene length
918 bp Sequence Blast
function
ribose uptake
product
ribose [SW|ABC transporter] (binding protein)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 1|Cellular processes] → [category|SW 1.2|Transporters] → [category|SW 1.2.1|ABC transporters] → [category|SW 1.2.1.1|Importers] → [category|SW 1.2.1.1.1|Uptake of carbon sources]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.4|Utilization of ribose]
  • [category|SW 6|Groups of genes] → [category|SW 6.12|Secreted proteins]
  • [category|SW 6|Groups of genes] → [category|SW 6.2|Membrane proteins]
  • Gene

    Coordinates
    3,706,145 3,707,062

    The protein

    Protein family

  • bacterial solute-binding protein 2 family (according to Swiss-Prot)
  • Structure

  • [PDB|2GX6] (from ''Escherichia coli k12 mutant'', 54% identity, 71% similarity)
  • [SW|Localization]

  • extracellular (signal peptide), lipid modification as retention signal [Pubmed|18957862]
  • attached to the cell membrane (via [protein|F1258E31151E137A850811B0C851D473CEFFD43B|RbsC]-[protein|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|RbsD]) [Pubmed|10092453]
  • Expression and Regulation

    Operons

    genes
    [gene|77AEAC0F06B4D5F062D4A2740794B7BFDDA31096|rbsR]-[gene|C229BD2C00B169CF4A99482E65B3F749AD9D51D8|rbsK]-[gene|F0E6F191FAF8F279462B09BF1FE4C6C752A57803|rbsD]-[gene|AB4A686F62550F90F5BD8D27DAADC9C33F1DA1DB|rbsA]-[gene|F1258E31151E137A850811B0C851D473CEFFD43B|rbsC]-[gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]
    description
    [Pubmed|7921236]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|7511775], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|7921236], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • [protein|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB]: activation, [Pubmed|7592460], in [regulon|E5110D9C36E8C55AFD1419987B14A53232165F20|AbrB regulon]
  • regulation

  • expressed upon transition into the stationary phase ([protein|search|AbrB]) [Pubmed|7592460]
  • view in new tab

    Biological materials

    Mutant

  • BKE35960 ([gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE35960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACCCTCCTAAGC, downstream forward: _UP4_TAATTGTCTGATGTTTAGGA
  • BKK35960 ([gene|1D67888E79B09956F9258F4068546D8C67103549|rbsB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK35960 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGTAAAACCCTCCTAAGC, downstream forward: _UP4_TAATTGTCTGATGTTTAGGA
  • References

  • 10092453,16872404,7511775,7592460,18957862,7921236