SubtiBank SubtiBank
ylmC
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

ylmC

sporulation protein
locus
BSU_15360
pI
5.64
mw
8.62 kDa
protein length
gene length
246 bp Sequence Blast
function
unknown
product
sporulation protein
essential
no
synonyms
thiQ

Genomic Context

      

categories

  • [category|SW 4|Lifestyles] → [category|SW 4.2|Sporulation] → [category|SW 4.2.1|Sporulation proteins] → [category|SW 4.2.1.4|Sporulation proteins/ other]
  • Gene

    Coordinates
    1,608,919 1,609,164

    Phenotypes of a mutant

  • a ''[gene|1D27C5E73571A737B80649BFCF517C5FF136DFFF|ylmC] [gene|AC541AB15B4A2BC345B471BD654299BAEC3E8635|ymxH]'' double mutant has a severe [SW|sporulation] defect (1% sporulation as compared to the wild type or single mutants), the block is at stage III of [SW|sporulation] [Pubmed|23396918]
  • The protein

    Protein family

  • YlmC/YmxH family (with [protein|AC541AB15B4A2BC345B471BD654299BAEC3E8635|YmxH], according to UniProt)
  • Paralogous protein(s)

  • [protein|AC541AB15B4A2BC345B471BD654299BAEC3E8635|YmxH]
  • Expression and Regulation

    Operons

    genes
    [gene|1D27C5E73571A737B80649BFCF517C5FF136DFFF|ylmC]
    description
    [pubmed|22383849]

    sigma factors

  • [protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE]: sigma factor, in [regulon|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|SigE regulon]
  • regulatory mechanism

  • [protein|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID]: repression, in [regulon|90DCE4F286D2C151D8BDBF0E024E6BBEC94E2397|SpoIIID regulon]
  • view in new tab

    Biological materials

    Mutant

  • MGNA-B170 (ylmC::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1169 NBRP B. subtilis, Japan]
  • BKE15360 ([gene|1D27C5E73571A737B80649BFCF517C5FF136DFFF|ylmC]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE15360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCATCACGTCCTTTTT, downstream forward: _UP4_TAAACCTGCTTGTCTGCCGC
  • BKK15360 ([gene|1D27C5E73571A737B80649BFCF517C5FF136DFFF|ylmC]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK15360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTCCATCACGTCCTTTTT, downstream forward: _UP4_TAAACCTGCTTGTCTGCCGC
  • References

  • 23123912,23396918