SubtiBank SubtiBank
levR
An ordered knock out library of all non-essential genes in B. subtilis is now available at Addgene. Information on ordering a copy can be found here. See Koo et al. 2017 for details about library construction.

levR

transcriptional activator of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|search|sacC ]operon
locus
BSU27080
pI
5.94
mw
105.99 kDa
protein length
938 aa Sequence Blast
gene length
2814 bp Sequence Blast
function
regulation of levan and fructose utilization
product
transcriptional activator, PRD-type(for [protein|1118A21CC581B0470EC6E7C178F2523CDCA70F93|SigL]-dependent promoter)
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.27|Utilization of other polymeric carbohydrates]
  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.7|Utilization of fructose]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.4|Phosphorylation on a His residue]
  • Gene

    Coordinates
    2,763,025 → 2,765,832

    The protein

    Catalyzed reaction/ biological activity

  • binding to the upstream activating sequence in front of the [gene|75C568C8F6912AC064B8B435975D52510D25466A|levD] gene results in activation of transcription of the ''[gene|75C568C8F6912AC064B8B435975D52510D25466A|levD]-[gene|CAE38D8F25A5EC6AC8045E40072E6FEC632045FA|levE]-[gene|8ABA3735067C7AA433E09F219EE7239196377A95|levF]-[gene|F23B951F60A6A669D5BD86836906E0F4AD7A0C1B|levG]-[gene|61D5B957E018D019AE0CE1D5F6C6A33EF982ED49|sacC]'' operon, bining occurs in the presence of fructose
  • Protein family

  • [SW|Transcription factors activating transcription at SigL-dependent promoters]
  • Modification

  • phosphorylation (His503, His582, His866) (according to Swiss-Prot)
  • [SW|Localization]

  • cytoplasm (according to Swiss-Prot)
  • Expression and Regulation

    Operons

    genes
    [gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]
    description
    [pubmed|22383849]
    view in new tab

    Biological materials

    Mutant

  • BKE27080 (Δ[gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE27080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCTATCATCCTTTGTC, downstream forward: _UP4_TAAAAACAGTTTTTTCATAT
  • BKK27080 (Δ[gene|1D2043CC0D8CF64142F0A5993A936C5A196726D4|levR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK27080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACGTCTATCATCCTTTGTC, downstream forward: _UP4_TAAAAACAGTTTTTTCATAT
  • References

  • 1900939,7592487,7592486,8057358,9033408,21906631,9622354