SubtiBank SubtiBank
mtlR
The second international online conference #Subtillery2021 will be held 14th - 18th June - save the date, for more information see the conference website!

The 21st International Conference on Bacilli has been postponed to 2022 and will take place in Prague.

mtlR

transcriptional activator of the [gene|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|mtlA]-[gene|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|mtlF]-[gene|4D54898D405EA25A0C74B1F02A492143D49B7B07|mtlD] operon
locus
BSU_04160
pI
5.31
mw
78.67 kDa
protein length
694 aa Sequence Blast
gene length
2085 bp Sequence Blast
function
regulation of mannitol utilization
product
transcriptional activator, PRD-type
essential
no
synonyms
ydaA

Genomic Context

      

categories

  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.2|Utilization of specific carbon sources] → [category|SW 2.2.2.10|Utilization of mannitol]
  • [category|SW 3|Information processing] → [category|SW 3.4|Regulation of gene expression] → [category|SW 3.4.2|Transcription factors and their control] → [category|SW 3.4.2.3|PRD-type regulators]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.3|Phosphorylation on a Cys residue]
  • Gene

    Coordinates
    467,130 469,214

    The protein

    Catalyzed reaction/ biological activity

  • D-mannitol + Nπ-phospho-L-histidyl-[protein] --> D-mannitol 1-phosphate + L-histidyl-[protein] (according to UniProt)
  • Protein family

  • [SW|PRD-containing transcription factors]
  • [SW|Domains]

  • N-terminal DNA-binding domains, two [SW|PTS]-regulation domains (PRD1 aa 195-300 and PRD2 aa 305-410), EIIB (Gat)-like domain, EIIA (Mtl)-like domain
  • [SW|PTS EIIB domain] type-2 (aa 413-502) (according to UniProt)
  • [SW|PTS EIIA domain] type-2 (aa 536-683) (according to UniProt)
  • Modification

  • phosphorylated on His-342 and/or His-399 by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH] [Pubmed|20444094]
  • phosphorylation on His-599 by [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|MtlA] [Pubmed|20444094]
  • phosphorylation on Cys-419 by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|MtlF] [Pubmed|20444094]
  • Effectors of protein activity

  • activity is stimulated by [protein|29B793660E4D30C0656248F3EF403FEF76FB9025|PtsH]-dependent phosphorylation in PRD2 (mechnism of carbon catabolite repression) [Pubmed|20444094]
  • activity is inhibited by [protein|EE4A4336E25F5DCAC89214F55CDE203AB47AA249|MtlF]-dependent phosphorylation in the EIIB(Gat)-like domain on Cys-419 (this prevents activity in the absence of mannitol and allows induction in presence of mannitol) [Pubmed|20444094]
  • [SW|Localization]

  • upon interaction with non-phosphorylated [protein|5291FEF41CA547223EDF9EBAFA38D3EE550ED3F3|MtlA], the active [protein|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|MtlR] localizes to the membrane [Pubmed|23279188]
  • Expression and Regulation

    Operons

    genes
    [gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]
    description
    [Pubmed|12897001]

    sigma factors

  • [protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA]: sigma factor, [Pubmed|22014119], in [regulon|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|SigA regulon]
  • regulatory mechanism

  • [protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA]: repression, [Pubmed|22900538], in [regulon|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|CcpA regulon]
  • regulation

  • repressed by glucose ([protein|search|CcpA]) [Pubmed|22900538]
  • view in new tab

    Biological materials

    Mutant

  • BKE04160 ([gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE04160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC, downstream forward: _UP4_TAAACCTGCATGGCACACGT
  • BKK04160 ([gene|1CEDC98C9EDD8F3DEA0AF4B2104DA1BF86E688C2|mtlR]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK04160 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAAAGACCTCCTAGC, downstream forward: _UP4_TAAACCTGCATGGCACACGT
  • References

    Reviews

  • 23318733,9663674
  • Original publications

  • 12897001,20444094,10627040,10702268,9988713,23279188,22900538,22014119,26159071