ssbB [2018-02-10T15:35:46.000Z]

single-strand DNA-binding proteinrequired to internalize and to recombine ssDNA with homologous resident duplex

locus: BSU36310

pI: 6.88

mw: 12.35 kDa

protein length: 113 aa

gene length: 339 bp

function: required for efficient genetic transformation

product: single-strand DNA-binding protein

essential: no

synonyms: ywpH

Genomic Context

categories

• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.1|DNA replication]
• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination]
• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.5|DNA repair/ recombination] → [category|SW 3.1.5.6|Other proteins]
• [category|SW 3|Information processing] → [category|SW 3.1|Genetics] → [category|SW 3.1.7|Genetic competence]
• [category|SW 4|Lifestyles] → [category|SW 4.1|Exponential and early post-exponential lifestyles] → [category|SW 4.1.3|Genetic competence]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.1|Phosphorylation on an Arg residue]
• [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.7|Phosphorylation on a Tyr residue]

Gene

Coordinates: 3,740,206 → 3,740,547

The protein

Catalyzed reaction/ biological activity

• binds and protects internalized foreign ssDNA [Pubmed|22373918]
• RecA-ATP in concert with [protein|FC53216F600994C862F0C0D017C3FA28EB75DCB6|DprA] and [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA] catalyzes DNA strand exchange, with [protein|1CDF658441061EA476E27C2E60DEE45C4F45AC15|SsbB] as an accessory factor [Pubmed|25138221]

Paralogous protein(s)

• [protein|8DE39680CA7663803A107066FBE9AFFCC77DB72A|SsbA]

Modification

• phosphorylated on Arg-55 [Pubmed|22517742]
• phosphorylated on Tyr by [protein|6100EA37592A2C31BC3DE79AD7948A8D6F65F6E1|PtkA], dephosphorylated by [protein|CF73D86DB024575BE8F043A4C3996458F4262E46|PtpZ] [Pubmed|16549871]

Effectors of protein activity

• phosphorylation strongly increases DNA-binding activity [Pubmed|16549871]

Structure

• [PDB|3VDY] (in complex with ssDNA) [Pubmed|22373918]

[SW|Localization]

• localizes to cell poles in competent cells [Pubmed|16009133]
• localizes to the DNA entry pole during transformation [Pubmed|22373918]
• transiently localizes to the cell pole, and co-localizes with the DNA uptake machinery [Pubmed|17630974]

Expression and Regulation

Operons

• genes: [gene|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB]
  description: [Pubmed|22383849]

  regulatory mechanism

  • [protein|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK]: activation, [Pubmed|11948146], in [regulon|08CFA2C72931A75532D4289BC1D18A826DE9F9CA|ComK regulon]

  regulation

  • expressed at the onset of stationary phase [Pubmed|14762004]

• genes: [gene|5BB6CE1D206F2BC278FD2F23CDAAE51CDAFFA2B6|ywpG]-[gene|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB]
  description: [Pubmed|22383849]

Biological materials

Mutant

• MGNA-A591 (ywpH::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/591 NBRP B. subtilis, Japan]
• BKE36310 (Δ[gene|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE36310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTCCTCCTCTCCT, downstream forward: _UP4_TGACACCCCTGCTCCTCCCG
• BKK36310 (Δ[gene|1CDF658441061EA476E27C2E60DEE45C4F45AC15|ssbB]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK36310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGATTCCTCCTCTCCT, downstream forward: _UP4_TGACACCCCTGCTCCTCCCG

Expression vector

• for expression, purification in E. coli with N-terminal His-tag, pRSETA available in Gerth lab

References

Reviews

• 22933559

Original publications

• 16009133,17630974,22373918,16549871,14762004,11948146,22383849,22517742,23536821,23779106,25138221,26707201